Incidental Mutation 'R4621:Lcn2'
ID346123
Institutional Source Beutler Lab
Gene Symbol Lcn2
Ensembl Gene ENSMUSG00000026822
Gene Namelipocalin 2
SynonymsNGAL, 24p3
MMRRC Submission 041886-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4621 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location32384633-32388252 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 32384643 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048792] [ENSMUST00000050785] [ENSMUST00000125818] [ENSMUST00000146423] [ENSMUST00000192241]
Predicted Effect probably benign
Transcript: ENSMUST00000048792
SMART Domains Protein: ENSMUSP00000038970
Gene: ENSMUSG00000039195

DomainStartEndE-ValueType
Pfam:UPF0184 1 83 5.5e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050785
SMART Domains Protein: ENSMUSP00000053962
Gene: ENSMUSG00000026822

DomainStartEndE-ValueType
Pfam:Lipocalin 48 195 2.2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125818
SMART Domains Protein: ENSMUSP00000117937
Gene: ENSMUSG00000039205

DomainStartEndE-ValueType
Blast:ZnF_U1 4 31 3e-6 BLAST
ZnF_U1 33 67 2.08e-1 SMART
ZnF_C2H2 36 60 3.02e0 SMART
low complexity region 96 116 N/A INTRINSIC
ZnF_U1 151 186 1.43e-4 SMART
ZnF_C2H2 154 179 9.56e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144569
Predicted Effect probably benign
Transcript: ENSMUST00000146423
SMART Domains Protein: ENSMUSP00000142021
Gene: ENSMUSG00000039195

DomainStartEndE-ValueType
Pfam:UPF0184 1 43 1.4e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155830
Predicted Effect probably benign
Transcript: ENSMUST00000192241
SMART Domains Protein: ENSMUSP00000141430
Gene: ENSMUSG00000026822

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
Pfam:Lipocalin 134 271 5.3e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192758
Meta Mutation Damage Score 0.0556 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the lipocalin family. Members of this family transport small hydrophobic molecules such as lipids, steroid hormones and retinoids. The protein encoded by this gene is a neutrophil gelatinase-associated lipocalin and plays a role in innate immunity by limiting bacterial growth as a result of sequestering iron-containing siderophores. The presence of this protein in blood and urine is an early biomarker of acute kidney injury. This protein is thought to be be involved in multiple cellular processes, including maintenance of skin homeostasis, and suppression of invasiveness and metastasis. Mice lacking this gene are more susceptible to bacterial infection than wild type mice. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutants are more susceptible to infection with bacteria that utilize enterochelin-type siderophores to acquire iron and impaired thermogenesis. Mice homozygous for another knock-out allele exhibit apoptotic defects in hematopoietic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik G A 1: 43,737,252 probably null Het
Abhd2 T C 7: 79,325,487 Y142H probably damaging Het
Abra C T 15: 41,869,224 D149N probably benign Het
Acin1 A T 14: 54,653,443 probably benign Het
Adap2 T A 11: 80,174,073 probably null Het
Afdn A G 17: 13,888,820 E1535G probably damaging Het
Ak9 A G 10: 41,406,891 N1218D possibly damaging Het
Angptl1 G A 1: 156,844,924 V107M probably damaging Het
Arhgap26 G A 18: 38,899,841 probably benign Het
Cage1 A C 13: 38,025,501 S61A possibly damaging Het
Cdadc1 T C 14: 59,586,555 T163A probably benign Het
Celsr2 A T 3: 108,395,216 V2568D possibly damaging Het
Cep44 G A 8: 56,542,916 T166M probably damaging Het
Cnksr3 T C 10: 7,126,182 K187E possibly damaging Het
Cyp20a1 A G 1: 60,376,099 T295A probably benign Het
Dus2 T A 8: 106,030,442 M88K probably damaging Het
E330034G19Rik A T 14: 24,296,002 probably benign Het
Efna5 T C 17: 62,651,045 D72G probably benign Het
Epb41l2 T C 10: 25,502,140 probably null Het
Espn A G 4: 152,131,252 S408P probably damaging Het
Evi5l T C 8: 4,202,909 probably benign Het
F830016B08Rik G A 18: 60,300,867 V341I probably benign Het
Flii A G 11: 60,716,111 L1013P possibly damaging Het
Fndc10 G A 4: 155,694,807 V103M probably damaging Het
Frem3 T A 8: 80,669,191 probably null Het
Gltp C T 5: 114,674,127 R106Q probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm996 G A 2: 25,578,400 P500S probably damaging Het
Gtf3c3 A G 1: 54,419,416 Y449H probably damaging Het
Hils1 G A 11: 94,968,160 V94M probably damaging Het
Hmga1b T C 11: 120,763,040 V51A probably damaging Het
Hsph1 A G 5: 149,618,843 V705A probably benign Het
Igkv13-84 T C 6: 68,939,799 S27P possibly damaging Het
Il15ra A G 2: 11,718,329 N55D possibly damaging Het
Kctd19 T G 8: 105,396,471 N104H probably damaging Het
Kif27 T G 13: 58,331,013 D572A probably benign Het
Larp1b G A 3: 40,963,989 G22R possibly damaging Het
Lmtk2 T A 5: 144,174,934 I824N probably benign Het
Ltbp2 A G 12: 84,809,348 I707T probably damaging Het
Macf1 A G 4: 123,372,348 probably null Het
Magel2 A T 7: 62,377,738 H130L unknown Het
Mcoln1 A G 8: 3,505,923 I73V probably damaging Het
Mycbp2 G T 14: 103,219,979 T1627K probably benign Het
Myh8 A G 11: 67,286,258 E412G probably damaging Het
Myo9a T A 9: 59,871,072 D1370E probably benign Het
Ndufaf5 A G 2: 140,183,925 T135A probably benign Het
Neb G A 2: 52,271,039 Q2207* probably null Het
Nek3 T C 8: 22,157,039 Y160C probably damaging Het
Olfr1371 G C 11: 52,213,879 L37V probably benign Het
Olfr175-ps1 A T 16: 58,824,106 I201N possibly damaging Het
Osbpl8 A G 10: 111,269,418 I245V probably benign Het
Pcdh9 T C 14: 93,887,643 I241V probably benign Het
Pcdhb12 A G 18: 37,437,160 Q453R probably benign Het
Pcdhb2 A G 18: 37,295,927 T318A probably benign Het
Prlr T A 15: 10,319,376 probably benign Het
Ptprz1 C T 6: 23,001,454 A1181V possibly damaging Het
Racgap1 C A 15: 99,626,206 S440I probably benign Het
Rap1gap2 A G 11: 74,435,699 probably null Het
Rbm5 A G 9: 107,754,146 V244A probably damaging Het
Rexo5 T G 7: 119,819,499 I254R probably benign Het
Robo2 A T 16: 73,985,933 S316T probably benign Het
Satb2 A T 1: 56,845,619 V382E probably damaging Het
Scg2 C T 1: 79,436,664 R114Q probably benign Het
Scube2 T C 7: 109,800,650 D893G possibly damaging Het
Snrpn T C 7: 59,987,526 D14G possibly damaging Het
Spag17 A G 3: 100,103,243 T2018A probably benign Het
Spata9 T G 13: 75,967,882 F17V possibly damaging Het
Supt6 A G 11: 78,212,746 Y1378H possibly damaging Het
Thsd7b T C 1: 129,430,915 S29P possibly damaging Het
Tmem59 A T 4: 107,190,718 probably benign Het
Tmem87a A G 2: 120,397,424 S81P probably benign Het
Togaram1 A T 12: 64,982,450 E882D possibly damaging Het
Trbj2-4 T A 6: 41,543,374 probably benign Het
Trim42 T A 9: 97,363,148 Y533F probably benign Het
Tssk5 C T 15: 76,372,468 R280Q probably benign Het
Vmn1r82 A G 7: 12,305,336 T179A possibly damaging Het
Yipf7 T A 5: 69,519,361 Q145L possibly damaging Het
Other mutations in Lcn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00935:Lcn2 APN 2 32387578 critical splice donor site probably null
IGL01327:Lcn2 APN 2 32386018 missense possibly damaging 0.62
IGL01913:Lcn2 APN 2 32387145 missense possibly damaging 0.46
IGL02108:Lcn2 APN 2 32387605 missense probably damaging 0.99
IGL02215:Lcn2 APN 2 32384865 makesense probably null
IGL02577:Lcn2 APN 2 32387089 missense probably damaging 0.97
IGL03129:Lcn2 APN 2 32387704 missense possibly damaging 0.70
R0302:Lcn2 UTSW 2 32384889 unclassified probably benign
R1864:Lcn2 UTSW 2 32385422 missense possibly damaging 0.77
R1865:Lcn2 UTSW 2 32385422 missense possibly damaging 0.77
R4093:Lcn2 UTSW 2 32387716 start codon destroyed probably null 1.00
R5236:Lcn2 UTSW 2 32385961 missense probably benign 0.06
R5716:Lcn2 UTSW 2 32385813 missense possibly damaging 0.88
R6785:Lcn2 UTSW 2 32387027 critical splice donor site probably null
R7059:Lcn2 UTSW 2 32387596 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TGGAATGCTACCGGTGTGAG -3'
(R):5'- CCAATGCATTGACAACTGAATGG -3'

Sequencing Primer
(F):5'- GTACACTGTAGCTGACTTCAGAC -3'
(R):5'- AATGGTTCAGGCGCTGC -3'
Posted On2015-09-25