Incidental Mutation 'R4621:Nek3'
ID346152
Institutional Source Beutler Lab
Gene Symbol Nek3
Ensembl Gene ENSMUSG00000031478
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 3
Synonyms
MMRRC Submission 041886-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4621 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location22128283-22166435 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22157039 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 160 (Y160C)
Ref Sequence ENSEMBL: ENSMUSP00000033865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033865] [ENSMUST00000110730] [ENSMUST00000178324]
Predicted Effect probably damaging
Transcript: ENSMUST00000033865
AA Change: Y160C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033865
Gene: ENSMUSG00000031478
AA Change: Y160C

DomainStartEndE-ValueType
S_TKc 4 259 1.11e-89 SMART
Blast:S_TKc 267 444 8e-49 BLAST
low complexity region 471 485 N/A INTRINSIC
low complexity region 495 506 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110730
AA Change: Y160C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106358
Gene: ENSMUSG00000031478
AA Change: Y160C

DomainStartEndE-ValueType
S_TKc 4 259 1.11e-89 SMART
Blast:S_TKc 267 446 1e-48 BLAST
low complexity region 473 487 N/A INTRINSIC
low complexity region 497 508 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178324
AA Change: Y160C

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000136876
Gene: ENSMUSG00000031478
AA Change: Y160C

DomainStartEndE-ValueType
S_TKc 4 259 1.11e-89 SMART
Blast:S_TKc 267 446 1e-48 BLAST
low complexity region 473 487 N/A INTRINSIC
low complexity region 497 508 N/A INTRINSIC
Meta Mutation Damage Score 0.354 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NimA (never in mitosis A) family of serine/threonine protein kinases. The encoded protein differs from other NimA family members in that it is not cell cycle regulated and is found primarily in the cytoplasm. The kinase is activated by prolactin stimulation, leading to phosphorylation of VAV2 guanine nucleotide exchange factor, paxillin, and activation of the RAC1 GTPase. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik G A 1: 43,737,252 probably null Het
Abhd2 T C 7: 79,325,487 Y142H probably damaging Het
Abra C T 15: 41,869,224 D149N probably benign Het
Acin1 A T 14: 54,653,443 probably benign Het
Adap2 T A 11: 80,174,073 probably null Het
Afdn A G 17: 13,888,820 E1535G probably damaging Het
Ak9 A G 10: 41,406,891 N1218D possibly damaging Het
Angptl1 G A 1: 156,844,924 V107M probably damaging Het
Arhgap26 G A 18: 38,899,841 probably benign Het
Cage1 A C 13: 38,025,501 S61A possibly damaging Het
Cdadc1 T C 14: 59,586,555 T163A probably benign Het
Celsr2 A T 3: 108,395,216 V2568D possibly damaging Het
Cep44 G A 8: 56,542,916 T166M probably damaging Het
Cnksr3 T C 10: 7,126,182 K187E possibly damaging Het
Cyp20a1 A G 1: 60,376,099 T295A probably benign Het
Dus2 T A 8: 106,030,442 M88K probably damaging Het
E330034G19Rik A T 14: 24,296,002 probably benign Het
Efna5 T C 17: 62,651,045 D72G probably benign Het
Epb41l2 T C 10: 25,502,140 probably null Het
Espn A G 4: 152,131,252 S408P probably damaging Het
Evi5l T C 8: 4,202,909 probably benign Het
F830016B08Rik G A 18: 60,300,867 V341I probably benign Het
Flii A G 11: 60,716,111 L1013P possibly damaging Het
Fndc10 G A 4: 155,694,807 V103M probably damaging Het
Frem3 T A 8: 80,669,191 probably null Het
Gltp C T 5: 114,674,127 R106Q probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm996 G A 2: 25,578,400 P500S probably damaging Het
Gtf3c3 A G 1: 54,419,416 Y449H probably damaging Het
Hils1 G A 11: 94,968,160 V94M probably damaging Het
Hmga1b T C 11: 120,763,040 V51A probably damaging Het
Hsph1 A G 5: 149,618,843 V705A probably benign Het
Igkv13-84 T C 6: 68,939,799 S27P possibly damaging Het
Il15ra A G 2: 11,718,329 N55D possibly damaging Het
Kctd19 T G 8: 105,396,471 N104H probably damaging Het
Kif27 T G 13: 58,331,013 D572A probably benign Het
Larp1b G A 3: 40,963,989 G22R possibly damaging Het
Lcn2 A T 2: 32,384,643 probably benign Het
Lmtk2 T A 5: 144,174,934 I824N probably benign Het
Ltbp2 A G 12: 84,809,348 I707T probably damaging Het
Macf1 A G 4: 123,372,348 probably null Het
Magel2 A T 7: 62,377,738 H130L unknown Het
Mcoln1 A G 8: 3,505,923 I73V probably damaging Het
Mycbp2 G T 14: 103,219,979 T1627K probably benign Het
Myh8 A G 11: 67,286,258 E412G probably damaging Het
Myo9a T A 9: 59,871,072 D1370E probably benign Het
Ndufaf5 A G 2: 140,183,925 T135A probably benign Het
Neb G A 2: 52,271,039 Q2207* probably null Het
Olfr1371 G C 11: 52,213,879 L37V probably benign Het
Olfr175-ps1 A T 16: 58,824,106 I201N possibly damaging Het
Osbpl8 A G 10: 111,269,418 I245V probably benign Het
Pcdh9 T C 14: 93,887,643 I241V probably benign Het
Pcdhb12 A G 18: 37,437,160 Q453R probably benign Het
Pcdhb2 A G 18: 37,295,927 T318A probably benign Het
Prlr T A 15: 10,319,376 probably benign Het
Ptprz1 C T 6: 23,001,454 A1181V possibly damaging Het
Racgap1 C A 15: 99,626,206 S440I probably benign Het
Rap1gap2 A G 11: 74,435,699 probably null Het
Rbm5 A G 9: 107,754,146 V244A probably damaging Het
Rexo5 T G 7: 119,819,499 I254R probably benign Het
Robo2 A T 16: 73,985,933 S316T probably benign Het
Satb2 A T 1: 56,845,619 V382E probably damaging Het
Scg2 C T 1: 79,436,664 R114Q probably benign Het
Scube2 T C 7: 109,800,650 D893G possibly damaging Het
Snrpn T C 7: 59,987,526 D14G possibly damaging Het
Spag17 A G 3: 100,103,243 T2018A probably benign Het
Spata9 T G 13: 75,967,882 F17V possibly damaging Het
Supt6 A G 11: 78,212,746 Y1378H possibly damaging Het
Thsd7b T C 1: 129,430,915 S29P possibly damaging Het
Tmem59 A T 4: 107,190,718 probably benign Het
Tmem87a A G 2: 120,397,424 S81P probably benign Het
Togaram1 A T 12: 64,982,450 E882D possibly damaging Het
Trbj2-4 T A 6: 41,543,374 probably benign Het
Trim42 T A 9: 97,363,148 Y533F probably benign Het
Tssk5 C T 15: 76,372,468 R280Q probably benign Het
Vmn1r82 A G 7: 12,305,336 T179A possibly damaging Het
Yipf7 T A 5: 69,519,361 Q145L possibly damaging Het
Other mutations in Nek3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Nek3 APN 8 22158706 missense probably damaging 1.00
IGL01561:Nek3 APN 8 22129456 missense probably damaging 0.97
IGL02799:Nek3 APN 8 22158719 splice site probably benign
IGL02826:Nek3 APN 8 22160368 critical splice donor site probably null
R0001:Nek3 UTSW 8 22158612 splice site probably benign
R0390:Nek3 UTSW 8 22128729 unclassified probably benign
R1367:Nek3 UTSW 8 22160361 splice site probably benign
R1565:Nek3 UTSW 8 22132201 critical splice acceptor site probably null
R1758:Nek3 UTSW 8 22160262 missense probably damaging 1.00
R1924:Nek3 UTSW 8 22157031 missense probably damaging 1.00
R3905:Nek3 UTSW 8 22133091 missense probably benign 0.01
R4078:Nek3 UTSW 8 22132137 missense probably damaging 1.00
R4089:Nek3 UTSW 8 22149913 missense probably damaging 1.00
R5207:Nek3 UTSW 8 22132227 intron probably benign
R5432:Nek3 UTSW 8 22148732 intron probably null
R5790:Nek3 UTSW 8 22131297 missense probably damaging 1.00
R5790:Nek3 UTSW 8 22131298 missense probably damaging 1.00
R6856:Nek3 UTSW 8 22129447 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCAATAAGCTCCGTGTATCTG -3'
(R):5'- CTGATGCTGGGACAAGCAAGAC -3'

Sequencing Primer
(F):5'- GTGTATCTGCACGGACTCC -3'
(R):5'- GAGTTCTTCCTTCTCGATGCAGAATG -3'
Posted On2015-09-25