Incidental Mutation 'R4622:Znfx1'
ID346213
Institutional Source Beutler Lab
Gene Symbol Znfx1
Ensembl Gene ENSMUSG00000039501
Gene Namezinc finger, NFX1-type containing 1
Synonyms
MMRRC Submission 041887-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4622 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location167035793-167063015 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 167041753 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 145 (T145A)
Ref Sequence ENSEMBL: ENSMUSP00000072867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048988] [ENSMUST00000067584] [ENSMUST00000128676] [ENSMUST00000155281]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048988
AA Change: T1009A

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000049404
Gene: ENSMUSG00000039501
AA Change: T1009A

DomainStartEndE-ValueType
Pfam:AAA_11 590 855 2.2e-17 PFAM
Pfam:AAA_19 597 684 1.7e-10 PFAM
Pfam:AAA_11 829 1033 1.4e-18 PFAM
Pfam:AAA_12 1044 1228 3.7e-42 PFAM
internal_repeat_2 1281 1374 1.33e-7 PROSPERO
internal_repeat_1 1292 1410 1.32e-16 PROSPERO
low complexity region 1422 1433 N/A INTRINSIC
internal_repeat_1 1434 1547 1.32e-16 PROSPERO
internal_repeat_2 1453 1555 1.33e-7 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000067584
AA Change: T145A

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072867
Gene: ENSMUSG00000039501
AA Change: T145A

DomainStartEndE-ValueType
Pfam:AAA_11 8 170 1.2e-17 PFAM
Pfam:AAA_12 180 364 7.4e-42 PFAM
internal_repeat_2 417 510 1.08e-6 PROSPERO
internal_repeat_1 428 546 1.81e-14 PROSPERO
low complexity region 558 569 N/A INTRINSIC
internal_repeat_1 570 683 1.81e-14 PROSPERO
internal_repeat_2 589 691 1.08e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000128676
SMART Domains Protein: ENSMUSP00000121598
Gene: ENSMUSG00000039501

DomainStartEndE-ValueType
Pfam:AAA_11 590 837 1.8e-17 PFAM
Pfam:AAA_19 597 684 3.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155281
SMART Domains Protein: ENSMUSP00000121750
Gene: ENSMUSG00000039501

DomainStartEndE-ValueType
Pfam:AAA_11 590 854 1.7e-17 PFAM
Pfam:AAA_19 597 684 3.6e-11 PFAM
Meta Mutation Damage Score 0.352 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (107/109)
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik G T 1: 43,742,321 R121L possibly damaging Het
2900011O08Rik A C 16: 14,093,922 E44A possibly damaging Het
Aadacl2 A T 3: 60,007,053 N26Y probably damaging Het
Aass C T 6: 23,092,330 D194N probably damaging Het
Acp7 T C 7: 28,614,397 Y404C probably damaging Het
Acsl1 A T 8: 46,526,373 I421L probably benign Het
Adgrb3 A T 1: 25,826,488 D91E probably damaging Het
Adgrg3 T C 8: 95,040,525 S503P probably damaging Het
Adgrg6 A T 10: 14,441,499 C526S probably damaging Het
Arhgap32 A T 9: 32,239,348 I15F possibly damaging Het
Arid1b G T 17: 4,995,050 probably benign Het
Asnsd1 A G 1: 53,348,219 V83A probably benign Het
Atg101 A G 15: 101,293,332 probably benign Het
Atp8a1 T C 5: 67,682,713 probably benign Het
Aurkb T A 11: 69,048,362 L137Q probably damaging Het
AY702103 A T 17: 50,240,001 noncoding transcript Het
B3gnt9 A G 8: 105,253,845 S304P probably benign Het
Babam2 T C 5: 32,007,312 V310A probably damaging Het
Batf A G 12: 85,708,553 D60G possibly damaging Het
Baz1a A T 12: 54,941,515 I283K probably benign Het
BC067074 A G 13: 113,320,081 D887G probably benign Het
Bst1 T G 5: 43,818,919 probably benign Het
C2 C A 17: 34,863,674 V490L probably damaging Het
Cacna1e T C 1: 154,471,565 E952G possibly damaging Het
Ccnyl1 A G 1: 64,718,258 D262G probably damaging Het
Cdc42bpa A T 1: 180,074,658 K493N probably damaging Het
Cenpe A G 3: 135,243,708 T85A probably benign Het
Ces2e T A 8: 104,928,709 probably null Het
Chd3 T A 11: 69,349,008 R1665W probably damaging Het
Cpm A G 10: 117,670,297 N188D possibly damaging Het
Ctnnd2 A T 15: 30,887,169 M781L probably benign Het
Ctnnd2 A G 15: 31,009,113 T1094A probably benign Het
Cux1 T C 5: 136,308,300 K657R probably damaging Het
Ddx54 G A 5: 120,626,423 V732M probably damaging Het
Efna5 T C 17: 62,651,045 D72G probably benign Het
Eva1c T A 16: 90,897,455 probably null Het
Evi5l T C 8: 4,202,909 probably benign Het
Fasl A G 1: 161,787,134 L120P probably benign Het
Gm10334 A T 6: 41,445,312 I53N probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
H2-M9 A T 17: 36,641,824 probably null Het
Hdgf C A 3: 87,914,577 N198K possibly damaging Het
Hspa9 A T 18: 34,949,037 M172K possibly damaging Het
Il1r1 A C 1: 40,312,420 L406F probably damaging Het
Il31 T C 5: 123,480,435 D96G probably damaging Het
Inhbc A G 10: 127,357,277 I290T probably benign Het
Lrp2 A T 2: 69,460,349 V3589D possibly damaging Het
Lrrc14 A T 15: 76,716,340 probably benign Het
Lyst G A 13: 13,674,398 A2057T probably benign Het
Macf1 A G 4: 123,372,348 probably null Het
Mapk10 C A 5: 102,989,724 G209V probably damaging Het
Mcoln1 A G 8: 3,505,923 I73V probably damaging Het
Met G T 6: 17,513,384 R411L probably benign Het
Mkl2 G A 16: 13,332,706 G102D probably damaging Het
Mrpl4 G A 9: 21,007,497 R176Q probably damaging Het
Mtmr3 T C 11: 4,491,067 T528A possibly damaging Het
Mtmr7 A T 8: 40,581,541 N246K probably damaging Het
Mycbp2 G T 14: 103,219,979 T1627K probably benign Het
Necab3 A G 2: 154,555,582 probably null Het
Nr1d1 C T 11: 98,769,884 C419Y probably damaging Het
Nwd1 C A 8: 72,667,300 A397E probably damaging Het
Oas1f A T 5: 120,848,327 K114N probably damaging Het
Olfr1136 T A 2: 87,693,643 K80* probably null Het
Olfr175-ps1 A T 16: 58,824,106 I201N possibly damaging Het
Olfr395 C A 11: 73,906,911 V194F possibly damaging Het
Olfr46 T A 7: 140,610,698 C169* probably null Het
Olfr613 G T 7: 103,552,154 R123L probably benign Het
Osbpl8 T C 10: 111,291,496 S814P probably benign Het
Pcdhgb7 A T 18: 37,753,130 Q451L probably benign Het
Pde7b C T 10: 20,418,792 R300Q probably damaging Het
Pgghg A G 7: 140,941,496 probably null Het
Plcg1 A G 2: 160,747,768 probably benign Het
Plxna2 A T 1: 194,812,150 I1892L probably benign Het
Ppt2 A G 17: 34,625,901 V123A probably benign Het
Prdx5 G T 19: 6,906,973 probably benign Het
Prpf40b A G 15: 99,316,316 D819G probably benign Het
Psap T G 10: 60,300,851 C536W probably damaging Het
Rab3gap1 T C 1: 127,942,419 C919R probably benign Het
Racgap1 C A 15: 99,626,206 S440I probably benign Het
Rec8 C T 14: 55,624,758 R480C probably damaging Het
Reg3d A G 6: 78,377,459 L53S probably benign Het
Rnft2 T A 5: 118,232,406 S244C probably damaging Het
Scn2a T C 2: 65,752,027 V1573A probably benign Het
Selenoo G T 15: 89,095,707 G353* probably null Het
Siva1 A G 12: 112,645,067 Y34C probably damaging Het
Slc2a4 C T 11: 69,944,774 probably benign Het
Slc39a12 A T 2: 14,400,325 T243S probably benign Het
Slc9b2 T C 3: 135,332,518 I453T probably damaging Het
Spag17 A G 3: 100,103,243 T2018A probably benign Het
Tbc1d24 A T 17: 24,208,891 D32E probably benign Het
Tet1 T A 10: 62,819,474 H1556L possibly damaging Het
Tmem59 A T 4: 107,190,718 probably benign Het
Ttn A T 2: 76,900,952 probably benign Het
Uimc1 A T 13: 55,077,494 L89H probably damaging Het
Vipas39 A G 12: 87,244,543 I343T probably damaging Het
Vmn2r71 G T 7: 85,620,609 V443L probably benign Het
Zbtb14 G A 17: 69,388,347 D347N possibly damaging Het
Zfp980 G T 4: 145,702,057 C452F probably damaging Het
Zmym5 T A 14: 56,812,236 probably benign Het
Other mutations in Znfx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Znfx1 APN 2 167036729 missense possibly damaging 0.65
IGL00492:Znfx1 APN 2 167036923 missense probably damaging 1.00
IGL01285:Znfx1 APN 2 167038695 missense possibly damaging 0.76
IGL01343:Znfx1 APN 2 167037363 missense probably benign 0.16
IGL01767:Znfx1 APN 2 167055723 missense probably damaging 1.00
IGL01983:Znfx1 APN 2 167056350 missense probably damaging 1.00
IGL02006:Znfx1 APN 2 167055763 missense probably damaging 1.00
IGL02254:Znfx1 APN 2 167055723 missense probably damaging 1.00
IGL02421:Znfx1 APN 2 167060080 missense probably damaging 0.97
IGL02496:Znfx1 APN 2 167047630 missense possibly damaging 0.83
IGL02525:Znfx1 APN 2 167037537 missense probably benign 0.00
IGL02528:Znfx1 APN 2 167050404 missense probably benign 0.11
IGL02537:Znfx1 APN 2 167056167 missense probably benign 0.37
IGL03065:Znfx1 APN 2 167055765 missense probably benign 0.00
R0127:Znfx1 UTSW 2 167044210 missense possibly damaging 0.84
R0331:Znfx1 UTSW 2 167046978 missense probably benign 0.11
R0488:Znfx1 UTSW 2 167042563 missense possibly damaging 0.52
R0497:Znfx1 UTSW 2 167055411 missense probably benign 0.03
R0537:Znfx1 UTSW 2 167041701 missense probably damaging 1.00
R0542:Znfx1 UTSW 2 167055655 missense probably damaging 1.00
R0650:Znfx1 UTSW 2 167047654 nonsense probably null
R0655:Znfx1 UTSW 2 167056907 missense probably damaging 1.00
R1104:Znfx1 UTSW 2 167055640 nonsense probably null
R1470:Znfx1 UTSW 2 167042587 missense possibly damaging 0.91
R1470:Znfx1 UTSW 2 167042587 missense possibly damaging 0.91
R1512:Znfx1 UTSW 2 167056317 missense probably benign 0.03
R1533:Znfx1 UTSW 2 167056788 missense probably benign 0.10
R1541:Znfx1 UTSW 2 167056190 missense probably damaging 0.99
R1642:Znfx1 UTSW 2 167039010 missense possibly damaging 0.95
R1720:Znfx1 UTSW 2 167044066 nonsense probably null
R1760:Znfx1 UTSW 2 167039866 missense probably damaging 0.96
R1865:Znfx1 UTSW 2 167038809 missense probably damaging 1.00
R1959:Znfx1 UTSW 2 167050350 missense probably damaging 1.00
R2088:Znfx1 UTSW 2 167055810 missense probably damaging 1.00
R4581:Znfx1 UTSW 2 167050316 missense probably damaging 1.00
R4649:Znfx1 UTSW 2 167056356 missense probably benign 0.08
R4685:Znfx1 UTSW 2 167039030 missense probably damaging 1.00
R4798:Znfx1 UTSW 2 167038569 unclassified probably null
R4827:Znfx1 UTSW 2 167044231 missense possibly damaging 0.77
R4870:Znfx1 UTSW 2 167055269 missense probably benign
R4910:Znfx1 UTSW 2 167036804 missense probably damaging 1.00
R4910:Znfx1 UTSW 2 167037482 missense probably benign 0.00
R5022:Znfx1 UTSW 2 167039826 missense probably damaging 1.00
R5023:Znfx1 UTSW 2 167039826 missense probably damaging 1.00
R5057:Znfx1 UTSW 2 167039826 missense probably damaging 1.00
R5061:Znfx1 UTSW 2 167065398 unclassified probably benign
R5119:Znfx1 UTSW 2 167065387 unclassified probably benign
R5125:Znfx1 UTSW 2 167046939 missense possibly damaging 0.81
R5896:Znfx1 UTSW 2 167039000 missense probably damaging 1.00
R6107:Znfx1 UTSW 2 167037081 missense possibly damaging 0.67
R6112:Znfx1 UTSW 2 167038206 missense probably benign
R6158:Znfx1 UTSW 2 167056726 missense probably benign 0.19
R6281:Znfx1 UTSW 2 167055885 missense probably damaging 1.00
R6464:Znfx1 UTSW 2 167046922 missense probably benign 0.34
R6749:Znfx1 UTSW 2 167056599 missense probably benign 0.00
R6888:Znfx1 UTSW 2 167038940 missense possibly damaging 0.91
R6973:Znfx1 UTSW 2 167056761 missense probably benign 0.18
R7017:Znfx1 UTSW 2 167048534 missense probably damaging 1.00
R7138:Znfx1 UTSW 2 167056777 missense probably benign 0.03
R7192:Znfx1 UTSW 2 167042190 missense probably benign 0.00
X0064:Znfx1 UTSW 2 167055256 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGCCCCAAGTGCAATCTC -3'
(R):5'- CTTAGTTTTCTGCCAGCCCAGG -3'

Sequencing Primer
(F):5'- CCAAGTGCAATCTCTAGTCATGAGG -3'
(R):5'- CCAGCCCAGGGAAGGTAC -3'
Posted On2015-09-25