Incidental Mutation 'R4622:Slc9b2'
ID346218
Institutional Source Beutler Lab
Gene Symbol Slc9b2
Ensembl Gene ENSMUSG00000037994
Gene Namesolute carrier family 9, subfamily B (NHA2, cation proton antiporter 2), member 2
SynonymsC80638, nha-oc, Nhedc2, NHE10, NHA2
MMRRC Submission 041887-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4622 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location135307700-135345387 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135332518 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 453 (I453T)
Ref Sequence ENSEMBL: ENSMUSP00000060640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051849] [ENSMUST00000145195]
Predicted Effect probably damaging
Transcript: ENSMUST00000051849
AA Change: I453T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000060640
Gene: ENSMUSG00000037994
AA Change: I453T

DomainStartEndE-ValueType
transmembrane domain 83 102 N/A INTRINSIC
Pfam:Na_H_Exchanger 116 515 4.4e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132405
Predicted Effect probably benign
Transcript: ENSMUST00000145195
SMART Domains Protein: ENSMUSP00000123083
Gene: ENSMUSG00000037994

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
transmembrane domain 47 69 N/A INTRINSIC
Meta Mutation Damage Score 0.2 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (107/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sodium hydrogen antiporters, such as NHEDC2, convert the proton motive force established by the respiratory chain or the F1F0 mitochondrial ATPase into sodium gradients that drive other energy-requiring processes, transduce environmental signals into cell responses, or function in drug efflux (Xiang et al., 2007 [PubMed 18000046]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and overtly normal, with no detectable abnormalities in osteoclast differentiation and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik G T 1: 43,742,321 R121L possibly damaging Het
2900011O08Rik A C 16: 14,093,922 E44A possibly damaging Het
Aadacl2 A T 3: 60,007,053 N26Y probably damaging Het
Aass C T 6: 23,092,330 D194N probably damaging Het
Acp7 T C 7: 28,614,397 Y404C probably damaging Het
Acsl1 A T 8: 46,526,373 I421L probably benign Het
Adgrb3 A T 1: 25,826,488 D91E probably damaging Het
Adgrg3 T C 8: 95,040,525 S503P probably damaging Het
Adgrg6 A T 10: 14,441,499 C526S probably damaging Het
Arhgap32 A T 9: 32,239,348 I15F possibly damaging Het
Arid1b G T 17: 4,995,050 probably benign Het
Asnsd1 A G 1: 53,348,219 V83A probably benign Het
Atg101 A G 15: 101,293,332 probably benign Het
Atp8a1 T C 5: 67,682,713 probably benign Het
Aurkb T A 11: 69,048,362 L137Q probably damaging Het
AY702103 A T 17: 50,240,001 noncoding transcript Het
B3gnt9 A G 8: 105,253,845 S304P probably benign Het
Babam2 T C 5: 32,007,312 V310A probably damaging Het
Batf A G 12: 85,708,553 D60G possibly damaging Het
Baz1a A T 12: 54,941,515 I283K probably benign Het
BC067074 A G 13: 113,320,081 D887G probably benign Het
Bst1 T G 5: 43,818,919 probably benign Het
C2 C A 17: 34,863,674 V490L probably damaging Het
Cacna1e T C 1: 154,471,565 E952G possibly damaging Het
Ccnyl1 A G 1: 64,718,258 D262G probably damaging Het
Cdc42bpa A T 1: 180,074,658 K493N probably damaging Het
Cenpe A G 3: 135,243,708 T85A probably benign Het
Ces2e T A 8: 104,928,709 probably null Het
Chd3 T A 11: 69,349,008 R1665W probably damaging Het
Cpm A G 10: 117,670,297 N188D possibly damaging Het
Ctnnd2 A T 15: 30,887,169 M781L probably benign Het
Ctnnd2 A G 15: 31,009,113 T1094A probably benign Het
Cux1 T C 5: 136,308,300 K657R probably damaging Het
Ddx54 G A 5: 120,626,423 V732M probably damaging Het
Efna5 T C 17: 62,651,045 D72G probably benign Het
Eva1c T A 16: 90,897,455 probably null Het
Evi5l T C 8: 4,202,909 probably benign Het
Fasl A G 1: 161,787,134 L120P probably benign Het
Gm10334 A T 6: 41,445,312 I53N probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
H2-M9 A T 17: 36,641,824 probably null Het
Hdgf C A 3: 87,914,577 N198K possibly damaging Het
Hspa9 A T 18: 34,949,037 M172K possibly damaging Het
Il1r1 A C 1: 40,312,420 L406F probably damaging Het
Il31 T C 5: 123,480,435 D96G probably damaging Het
Inhbc A G 10: 127,357,277 I290T probably benign Het
Lrp2 A T 2: 69,460,349 V3589D possibly damaging Het
Lrrc14 A T 15: 76,716,340 probably benign Het
Lyst G A 13: 13,674,398 A2057T probably benign Het
Macf1 A G 4: 123,372,348 probably null Het
Mapk10 C A 5: 102,989,724 G209V probably damaging Het
Mcoln1 A G 8: 3,505,923 I73V probably damaging Het
Met G T 6: 17,513,384 R411L probably benign Het
Mkl2 G A 16: 13,332,706 G102D probably damaging Het
Mrpl4 G A 9: 21,007,497 R176Q probably damaging Het
Mtmr3 T C 11: 4,491,067 T528A possibly damaging Het
Mtmr7 A T 8: 40,581,541 N246K probably damaging Het
Mycbp2 G T 14: 103,219,979 T1627K probably benign Het
Necab3 A G 2: 154,555,582 probably null Het
Nr1d1 C T 11: 98,769,884 C419Y probably damaging Het
Nwd1 C A 8: 72,667,300 A397E probably damaging Het
Oas1f A T 5: 120,848,327 K114N probably damaging Het
Olfr1136 T A 2: 87,693,643 K80* probably null Het
Olfr175-ps1 A T 16: 58,824,106 I201N possibly damaging Het
Olfr395 C A 11: 73,906,911 V194F possibly damaging Het
Olfr46 T A 7: 140,610,698 C169* probably null Het
Olfr613 G T 7: 103,552,154 R123L probably benign Het
Osbpl8 T C 10: 111,291,496 S814P probably benign Het
Pcdhgb7 A T 18: 37,753,130 Q451L probably benign Het
Pde7b C T 10: 20,418,792 R300Q probably damaging Het
Pgghg A G 7: 140,941,496 probably null Het
Plcg1 A G 2: 160,747,768 probably benign Het
Plxna2 A T 1: 194,812,150 I1892L probably benign Het
Ppt2 A G 17: 34,625,901 V123A probably benign Het
Prdx5 G T 19: 6,906,973 probably benign Het
Prpf40b A G 15: 99,316,316 D819G probably benign Het
Psap T G 10: 60,300,851 C536W probably damaging Het
Rab3gap1 T C 1: 127,942,419 C919R probably benign Het
Racgap1 C A 15: 99,626,206 S440I probably benign Het
Rec8 C T 14: 55,624,758 R480C probably damaging Het
Reg3d A G 6: 78,377,459 L53S probably benign Het
Rnft2 T A 5: 118,232,406 S244C probably damaging Het
Scn2a T C 2: 65,752,027 V1573A probably benign Het
Selenoo G T 15: 89,095,707 G353* probably null Het
Siva1 A G 12: 112,645,067 Y34C probably damaging Het
Slc2a4 C T 11: 69,944,774 probably benign Het
Slc39a12 A T 2: 14,400,325 T243S probably benign Het
Spag17 A G 3: 100,103,243 T2018A probably benign Het
Tbc1d24 A T 17: 24,208,891 D32E probably benign Het
Tet1 T A 10: 62,819,474 H1556L possibly damaging Het
Tmem59 A T 4: 107,190,718 probably benign Het
Ttn A T 2: 76,900,952 probably benign Het
Uimc1 A T 13: 55,077,494 L89H probably damaging Het
Vipas39 A G 12: 87,244,543 I343T probably damaging Het
Vmn2r71 G T 7: 85,620,609 V443L probably benign Het
Zbtb14 G A 17: 69,388,347 D347N possibly damaging Het
Zfp980 G T 4: 145,702,057 C452F probably damaging Het
Zmym5 T A 14: 56,812,236 probably benign Het
Znfx1 T C 2: 167,041,753 T145A possibly damaging Het
Other mutations in Slc9b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Slc9b2 APN 3 135336395 missense probably benign 0.17
IGL03091:Slc9b2 APN 3 135329030 missense probably damaging 0.97
IGL03203:Slc9b2 APN 3 135326212 missense probably damaging 1.00
IGL03377:Slc9b2 APN 3 135336358 missense probably damaging 1.00
IGL02988:Slc9b2 UTSW 3 135318418 missense probably benign 0.02
R0008:Slc9b2 UTSW 3 135336508 missense possibly damaging 0.72
R0382:Slc9b2 UTSW 3 135318422 missense probably damaging 0.99
R0628:Slc9b2 UTSW 3 135323775 splice site probably benign
R1263:Slc9b2 UTSW 3 135336395 missense probably benign 0.17
R1478:Slc9b2 UTSW 3 135326102 missense probably benign 0.45
R1809:Slc9b2 UTSW 3 135317131 missense possibly damaging 0.90
R2060:Slc9b2 UTSW 3 135326266 missense probably damaging 0.99
R2119:Slc9b2 UTSW 3 135328982 splice site probably null
R3196:Slc9b2 UTSW 3 135336529 missense probably benign 0.04
R3805:Slc9b2 UTSW 3 135324588 missense probably damaging 1.00
R4127:Slc9b2 UTSW 3 135329837 missense probably benign 0.00
R4401:Slc9b2 UTSW 3 135336544 missense probably benign 0.04
R4402:Slc9b2 UTSW 3 135336544 missense probably benign 0.04
R6125:Slc9b2 UTSW 3 135330696 splice site probably null
R7081:Slc9b2 UTSW 3 135321937 missense probably benign 0.10
R7166:Slc9b2 UTSW 3 135326178 missense unknown
R7203:Slc9b2 UTSW 3 135330661 missense probably benign 0.04
R7307:Slc9b2 UTSW 3 135318390 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AAGGCAGAAGCATCAGCATC -3'
(R):5'- ACCTTCTCTCTGGTGAGTGAAC -3'

Sequencing Primer
(F):5'- AGGAAAAGATTTCAAGCAATGATTG -3'
(R):5'- GAGACTTTGAGACTACTGTAAAATCC -3'
Posted On2015-09-25