Incidental Mutation 'R4623:Adgrg6'
ID346340
Institutional Source Beutler Lab
Gene Symbol Adgrg6
Ensembl Gene ENSMUSG00000039116
Gene Nameadhesion G protein-coupled receptor G6
SynonymsLOC215798, 1190004A11Rik, DREG, Gpr126
MMRRC Submission 041888-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4623 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location14402583-14545659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 14441499 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 526 (C526S)
Ref Sequence ENSEMBL: ENSMUSP00000146821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041168] [ENSMUST00000208429]
Predicted Effect probably damaging
Transcript: ENSMUST00000041168
AA Change: C498S

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000043055
Gene: ENSMUSG00000039116
AA Change: C498S

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
CUB 41 149 8.59e-33 SMART
low complexity region 609 620 N/A INTRINSIC
low complexity region 695 706 N/A INTRINSIC
GPS 769 822 2.48e-12 SMART
Pfam:7tm_2 831 1080 4.1e-52 PFAM
low complexity region 1122 1154 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000208429
AA Change: C526S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.18 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which is upregulated in human umbilical vein endothelial cells, encodes a G protein-coupled receptor. Variations in this gene can affect a person's stature. Multiple transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a null mutation die during organogenesis and display signs of circulatory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik T C 9: 94,520,398 N404D possibly damaging Het
1700034J04Rik T C 12: 11,222,140 noncoding transcript Het
A930003A15Rik C T 16: 19,883,737 noncoding transcript Het
Abca13 A G 11: 9,309,130 Y2952C probably damaging Het
Actrt2 T C 4: 154,667,290 T130A probably benign Het
Adamts7 T A 9: 90,186,462 D475E probably benign Het
Adgrf5 A G 17: 43,450,983 S1190G probably benign Het
Aldoc T C 11: 78,325,121 V151A probably damaging Het
Arsj A T 3: 126,364,796 E8V probably benign Het
Asph T C 4: 9,622,005 K167E possibly damaging Het
Auts2 G A 5: 131,440,383 P475S probably benign Het
C1d A G 11: 17,262,742 D29G possibly damaging Het
Calb1 T A 4: 15,895,721 probably benign Het
Ceacam15 A T 7: 16,673,466 F42Y probably damaging Het
Cpm A G 10: 117,670,297 N188D possibly damaging Het
Cts6 A T 13: 61,202,160 Y36N possibly damaging Het
Cux1 T C 5: 136,308,300 K657R probably damaging Het
Cyp2a22 G T 7: 26,933,491 P429T probably damaging Het
Dock3 T C 9: 107,062,045 E168G possibly damaging Het
Dot1l A G 10: 80,782,150 N324S probably benign Het
Dusp13 A C 14: 21,743,478 probably benign Het
Eif4g1 T A 16: 20,681,345 probably benign Het
Fan1 G T 7: 64,373,553 Y121* probably null Het
Foxn4 T C 5: 114,260,930 E80G possibly damaging Het
Gal3st2c C A 1: 94,009,456 H374Q possibly damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm973 A T 1: 59,556,276 I409F probably damaging Het
Gpr18 T A 14: 121,912,167 T149S probably damaging Het
Gsr A G 8: 33,680,305 E206G probably damaging Het
Hal A G 10: 93,507,439 H515R probably damaging Het
Heatr5b A G 17: 78,795,119 S1277P possibly damaging Het
Hmcn2 A G 2: 31,396,710 E2125G probably damaging Het
Ikzf4 A G 10: 128,641,119 C108R probably damaging Het
Kcnh2 A G 5: 24,348,442 V59A probably benign Het
Khdrbs1 A G 4: 129,720,842 V306A probably benign Het
Kif11 A T 19: 37,409,747 I674L probably benign Het
Lrp1b A T 2: 41,246,021 C1646S probably damaging Het
Ltbp2 A G 12: 84,809,348 I707T probably damaging Het
Macf1 A G 4: 123,372,348 probably null Het
Mib1 C A 18: 10,808,086 N944K probably benign Het
Mical3 C A 6: 120,961,625 E262* probably null Het
Mms22l C T 4: 24,502,792 Q55* probably null Het
Mrps11 T C 7: 78,791,941 probably null Het
Myh8 A G 11: 67,286,258 E412G probably damaging Het
Myo9a T A 9: 59,871,072 D1370E probably benign Het
Ncapd2 A G 6: 125,173,609 V843A probably benign Het
Nell1 A G 7: 50,120,562 E123G possibly damaging Het
Nkd1 A G 8: 88,589,755 D213G probably benign Het
Nlrp1b T C 11: 71,161,843 T920A probably benign Het
Olfr1090 T A 2: 86,754,562 M59L possibly damaging Het
Olfr175-ps1 A T 16: 58,824,106 I201N possibly damaging Het
Olfr784 G A 10: 129,388,046 V138M probably benign Het
Pde8b C T 13: 95,041,939 A566T possibly damaging Het
Pds5b T A 5: 150,800,601 S1214R probably benign Het
Pld1 T C 3: 28,029,244 I171T probably benign Het
Plekha5 T A 6: 140,551,186 V154E probably damaging Het
Plxna2 A T 1: 194,812,150 I1892L probably benign Het
Ppp1r16b A G 2: 158,761,463 Y436C possibly damaging Het
Proc T A 18: 32,127,473 T200S probably benign Het
Psap T G 10: 60,300,851 C536W probably damaging Het
Ptger2 G A 14: 44,989,014 R17H possibly damaging Het
Rab42 A G 4: 132,303,193 F49L possibly damaging Het
Racgap1 C A 15: 99,626,206 S440I probably benign Het
Rdh10 G A 1: 16,131,063 probably benign Het
Rnft2 T A 5: 118,232,406 S244C probably damaging Het
Sftpc T C 14: 70,522,278 probably null Het
Shcbp1 A C 8: 4,739,178 V547G probably damaging Het
Slc6a13 T C 6: 121,325,145 S229P probably damaging Het
Soat2 A T 15: 102,157,709 probably benign Het
Swap70 A G 7: 110,267,872 K294E probably benign Het
Tcim C A 8: 24,438,709 R63L probably damaging Het
Tek G A 4: 94,863,661 V1013I probably damaging Het
Tg T A 15: 66,735,271 M219K probably benign Het
Tie1 A G 4: 118,486,611 S45P possibly damaging Het
Tmem59 A T 4: 107,190,718 probably benign Het
Togaram1 A T 12: 64,982,450 E882D possibly damaging Het
Tram1l1 T A 3: 124,321,860 M223K possibly damaging Het
Tssk5 C T 15: 76,372,468 R280Q probably benign Het
Uspl1 T A 5: 149,214,595 D669E probably damaging Het
Vav1 C A 17: 57,299,839 probably null Het
Vcl A T 14: 21,014,939 E634V probably benign Het
Zfp672 A T 11: 58,316,455 C347S probably benign Het
Other mutations in Adgrg6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Adgrg6 APN 10 14467450 missense probably damaging 0.99
IGL00428:Adgrg6 APN 10 14467375 missense probably benign
IGL00489:Adgrg6 APN 10 14440403 splice site probably null
IGL00496:Adgrg6 APN 10 14450578 critical splice donor site probably null
IGL00743:Adgrg6 APN 10 14535959 splice site probably benign
IGL01011:Adgrg6 APN 10 14409798 missense probably damaging 0.96
IGL01291:Adgrg6 APN 10 14410530 missense possibly damaging 0.92
IGL01453:Adgrg6 APN 10 14420458 missense possibly damaging 0.94
IGL01594:Adgrg6 APN 10 14434340 missense probably damaging 1.00
IGL02013:Adgrg6 APN 10 14426811 missense probably damaging 0.98
IGL02037:Adgrg6 APN 10 14441441 missense probably damaging 0.98
IGL02070:Adgrg6 APN 10 14467592 missense probably damaging 1.00
IGL02164:Adgrg6 APN 10 14523555 intron probably benign
IGL02262:Adgrg6 APN 10 14441396 missense probably benign 0.00
IGL02272:Adgrg6 APN 10 14468829 missense probably damaging 1.00
IGL02605:Adgrg6 APN 10 14467232 missense probably damaging 1.00
IGL02800:Adgrg6 APN 10 14420605 missense probably damaging 1.00
IGL03175:Adgrg6 APN 10 14439758 missense probably benign 0.04
ANU05:Adgrg6 UTSW 10 14410530 missense possibly damaging 0.92
R0245:Adgrg6 UTSW 10 14458066 splice site probably benign
R0356:Adgrg6 UTSW 10 14426898 missense possibly damaging 0.47
R0388:Adgrg6 UTSW 10 14450658 missense probably benign 0.00
R0508:Adgrg6 UTSW 10 14450616 missense probably benign 0.32
R0626:Adgrg6 UTSW 10 14436884 missense probably damaging 1.00
R1116:Adgrg6 UTSW 10 14438428 missense probably benign 0.00
R1205:Adgrg6 UTSW 10 14434339 missense probably damaging 1.00
R1438:Adgrg6 UTSW 10 14468841 missense possibly damaging 0.68
R1599:Adgrg6 UTSW 10 14467313 nonsense probably null
R1714:Adgrg6 UTSW 10 14439770 missense possibly damaging 0.64
R1728:Adgrg6 UTSW 10 14439782 missense probably damaging 1.00
R1729:Adgrg6 UTSW 10 14439782 missense probably damaging 1.00
R1784:Adgrg6 UTSW 10 14439782 missense probably damaging 1.00
R2124:Adgrg6 UTSW 10 14467186 missense probably damaging 0.98
R2906:Adgrg6 UTSW 10 14432950 missense probably benign 0.03
R3410:Adgrg6 UTSW 10 14440370 missense probably benign 0.10
R3982:Adgrg6 UTSW 10 14448845 missense probably benign 0.10
R4376:Adgrg6 UTSW 10 14438494 missense probably benign 0.02
R4376:Adgrg6 UTSW 10 14469050 missense probably damaging 1.00
R4445:Adgrg6 UTSW 10 14409763 missense probably damaging 1.00
R4446:Adgrg6 UTSW 10 14409763 missense probably damaging 1.00
R4472:Adgrg6 UTSW 10 14436781 missense probably damaging 1.00
R4622:Adgrg6 UTSW 10 14441499 missense probably damaging 1.00
R4649:Adgrg6 UTSW 10 14468827 missense probably damaging 1.00
R4882:Adgrg6 UTSW 10 14434337 missense possibly damaging 0.88
R4978:Adgrg6 UTSW 10 14420461 missense probably damaging 1.00
R5246:Adgrg6 UTSW 10 14426765 missense probably damaging 1.00
R5420:Adgrg6 UTSW 10 14426986 nonsense probably null
R5461:Adgrg6 UTSW 10 14420504 missense probably damaging 1.00
R5580:Adgrg6 UTSW 10 14410484 nonsense probably null
R5644:Adgrg6 UTSW 10 14432934 missense probably damaging 1.00
R5847:Adgrg6 UTSW 10 14426777 missense probably damaging 1.00
R5900:Adgrg6 UTSW 10 14438419 critical splice donor site probably null
R6302:Adgrg6 UTSW 10 14441483 missense probably benign 0.22
R6318:Adgrg6 UTSW 10 14467497 missense probably benign
R6319:Adgrg6 UTSW 10 14431622 missense probably damaging 1.00
R6339:Adgrg6 UTSW 10 14434347 missense probably damaging 1.00
R6683:Adgrg6 UTSW 10 14456167 missense probably damaging 0.97
R6983:Adgrg6 UTSW 10 14431695 missense probably damaging 1.00
R7337:Adgrg6 UTSW 10 14467351 missense possibly damaging 0.82
R7378:Adgrg6 UTSW 10 14535892 missense probably benign 0.16
R7463:Adgrg6 UTSW 10 14434396 missense possibly damaging 0.82
R7470:Adgrg6 UTSW 10 14444066 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCTGTGACATGGATAGCAAG -3'
(R):5'- CGACATTTTGAAACTTTCAGGC -3'

Sequencing Primer
(F):5'- TAGCAAGCTTAGACATGTGAGTAGTC -3'
(R):5'- TGAAACTTTCAGGCTTTGTTCTC -3'
Posted On2015-09-25