Incidental Mutation 'R4623:Pde8b'
ID346358
Institutional Source Beutler Lab
Gene Symbol Pde8b
Ensembl Gene ENSMUSG00000021684
Gene Namephosphodiesterase 8B
SynonymsB230331L10Rik, C030047E14Rik
MMRRC Submission 041888-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R4623 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location95024454-95250336 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 95041939 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 566 (A566T)
Ref Sequence ENSEMBL: ENSMUSP00000125191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022192] [ENSMUST00000067082] [ENSMUST00000159608] [ENSMUST00000160957] [ENSMUST00000162153] [ENSMUST00000162292] [ENSMUST00000162412] [ENSMUST00000172104]
Predicted Effect probably benign
Transcript: ENSMUST00000022192
AA Change: A566T

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000022192
Gene: ENSMUSG00000021684
AA Change: A566T

DomainStartEndE-ValueType
Pfam:PDE8 1 52 2.2e-39 PFAM
low complexity region 75 98 N/A INTRINSIC
Pfam:Response_reg 134 252 2.9e-15 PFAM
Blast:HDc 420 481 1e-20 BLAST
HDc 565 748 3.01e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000067082
AA Change: A593T

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000070465
Gene: ENSMUSG00000021684
AA Change: A593T

DomainStartEndE-ValueType
Pfam:PDE8 1 47 1.4e-32 PFAM
low complexity region 75 98 N/A INTRINSIC
Blast:REC 112 235 6e-45 BLAST
PAS 249 316 3.59e-3 SMART
Blast:HDc 447 508 1e-20 BLAST
HDc 592 775 3.01e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159608
AA Change: A566T

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125191
Gene: ENSMUSG00000021684
AA Change: A566T

DomainStartEndE-ValueType
Pfam:PDE8 1 52 1.7e-39 PFAM
low complexity region 75 98 N/A INTRINSIC
Pfam:Response_reg 134 252 2.1e-15 PFAM
Blast:HDc 420 481 1e-20 BLAST
HDc 565 666 9.37e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160412
Predicted Effect probably benign
Transcript: ENSMUST00000160957
SMART Domains Protein: ENSMUSP00000125115
Gene: ENSMUSG00000021684

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:Response_reg 30 148 5.7e-16 PFAM
Blast:PAS 165 188 1e-7 BLAST
Blast:HDc 266 327 1e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162153
AA Change: A508T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000124704
Gene: ENSMUSG00000021684
AA Change: A508T

DomainStartEndE-ValueType
Pfam:Response_reg 29 147 2.6e-15 PFAM
PAS 164 231 3.59e-3 SMART
Blast:HDc 362 423 1e-20 BLAST
HDc 507 690 3.01e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000162292
AA Change: A516T

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124068
Gene: ENSMUSG00000021684
AA Change: A516T

DomainStartEndE-ValueType
Pfam:PDE8 1 52 2.1e-39 PFAM
low complexity region 75 98 N/A INTRINSIC
Pfam:Response_reg 134 252 2.6e-15 PFAM
Blast:HDc 370 431 1e-20 BLAST
HDc 515 698 3.01e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162412
AA Change: A458T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000124409
Gene: ENSMUSG00000021684
AA Change: A458T

DomainStartEndE-ValueType
Pfam:Response_reg 29 147 2.3e-15 PFAM
PAS 164 231 3.59e-3 SMART
Blast:HDc 312 373 1e-20 BLAST
HDc 457 640 3.01e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162882
Predicted Effect probably benign
Transcript: ENSMUST00000172104
AA Change: A558T

PolyPhen 2 Score 0.374 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000128987
Gene: ENSMUSG00000021684
AA Change: A558T

DomainStartEndE-ValueType
Pfam:PDE8 1 52 2.2e-39 PFAM
low complexity region 75 98 N/A INTRINSIC
Pfam:Response_reg 134 252 2.8e-15 PFAM
PAS 269 336 3.59e-3 SMART
HDc 557 740 3.01e-3 SMART
Meta Mutation Damage Score 0.098 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cyclic nucleotide phosphodiesterase (PDE) that catalyzes the hydrolysis of the second messenger cAMP. The encoded protein, which does not hydrolyze cGMP, is resistant to several PDE inhibitors. Defects in this gene are a cause of autosomal dominant striatal degeneration (ADSD). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased uring corticosterone, decreased serum adrenocorticotropin and decreased sensitivity to a PDE8-selective inhibitor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik T C 9: 94,520,398 N404D possibly damaging Het
1700034J04Rik T C 12: 11,222,140 noncoding transcript Het
A930003A15Rik C T 16: 19,883,737 noncoding transcript Het
Abca13 A G 11: 9,309,130 Y2952C probably damaging Het
Actrt2 T C 4: 154,667,290 T130A probably benign Het
Adamts7 T A 9: 90,186,462 D475E probably benign Het
Adgrf5 A G 17: 43,450,983 S1190G probably benign Het
Adgrg6 A T 10: 14,441,499 C526S probably damaging Het
Aldoc T C 11: 78,325,121 V151A probably damaging Het
Arsj A T 3: 126,364,796 E8V probably benign Het
Asph T C 4: 9,622,005 K167E possibly damaging Het
Auts2 G A 5: 131,440,383 P475S probably benign Het
C1d A G 11: 17,262,742 D29G possibly damaging Het
Calb1 T A 4: 15,895,721 probably benign Het
Ceacam15 A T 7: 16,673,466 F42Y probably damaging Het
Cpm A G 10: 117,670,297 N188D possibly damaging Het
Cts6 A T 13: 61,202,160 Y36N possibly damaging Het
Cux1 T C 5: 136,308,300 K657R probably damaging Het
Cyp2a22 G T 7: 26,933,491 P429T probably damaging Het
Dock3 T C 9: 107,062,045 E168G possibly damaging Het
Dot1l A G 10: 80,782,150 N324S probably benign Het
Dusp13 A C 14: 21,743,478 probably benign Het
Eif4g1 T A 16: 20,681,345 probably benign Het
Fan1 G T 7: 64,373,553 Y121* probably null Het
Foxn4 T C 5: 114,260,930 E80G possibly damaging Het
Gal3st2c C A 1: 94,009,456 H374Q possibly damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm973 A T 1: 59,556,276 I409F probably damaging Het
Gpr18 T A 14: 121,912,167 T149S probably damaging Het
Gsr A G 8: 33,680,305 E206G probably damaging Het
Hal A G 10: 93,507,439 H515R probably damaging Het
Heatr5b A G 17: 78,795,119 S1277P possibly damaging Het
Hmcn2 A G 2: 31,396,710 E2125G probably damaging Het
Ikzf4 A G 10: 128,641,119 C108R probably damaging Het
Kcnh2 A G 5: 24,348,442 V59A probably benign Het
Khdrbs1 A G 4: 129,720,842 V306A probably benign Het
Kif11 A T 19: 37,409,747 I674L probably benign Het
Lrp1b A T 2: 41,246,021 C1646S probably damaging Het
Ltbp2 A G 12: 84,809,348 I707T probably damaging Het
Macf1 A G 4: 123,372,348 probably null Het
Mib1 C A 18: 10,808,086 N944K probably benign Het
Mical3 C A 6: 120,961,625 E262* probably null Het
Mms22l C T 4: 24,502,792 Q55* probably null Het
Mrps11 T C 7: 78,791,941 probably null Het
Myh8 A G 11: 67,286,258 E412G probably damaging Het
Myo9a T A 9: 59,871,072 D1370E probably benign Het
Ncapd2 A G 6: 125,173,609 V843A probably benign Het
Nell1 A G 7: 50,120,562 E123G possibly damaging Het
Nkd1 A G 8: 88,589,755 D213G probably benign Het
Nlrp1b T C 11: 71,161,843 T920A probably benign Het
Olfr1090 T A 2: 86,754,562 M59L possibly damaging Het
Olfr175-ps1 A T 16: 58,824,106 I201N possibly damaging Het
Olfr784 G A 10: 129,388,046 V138M probably benign Het
Pds5b T A 5: 150,800,601 S1214R probably benign Het
Pld1 T C 3: 28,029,244 I171T probably benign Het
Plekha5 T A 6: 140,551,186 V154E probably damaging Het
Plxna2 A T 1: 194,812,150 I1892L probably benign Het
Ppp1r16b A G 2: 158,761,463 Y436C possibly damaging Het
Proc T A 18: 32,127,473 T200S probably benign Het
Psap T G 10: 60,300,851 C536W probably damaging Het
Ptger2 G A 14: 44,989,014 R17H possibly damaging Het
Rab42 A G 4: 132,303,193 F49L possibly damaging Het
Racgap1 C A 15: 99,626,206 S440I probably benign Het
Rdh10 G A 1: 16,131,063 probably benign Het
Rnft2 T A 5: 118,232,406 S244C probably damaging Het
Sftpc T C 14: 70,522,278 probably null Het
Shcbp1 A C 8: 4,739,178 V547G probably damaging Het
Slc6a13 T C 6: 121,325,145 S229P probably damaging Het
Soat2 A T 15: 102,157,709 probably benign Het
Swap70 A G 7: 110,267,872 K294E probably benign Het
Tcim C A 8: 24,438,709 R63L probably damaging Het
Tek G A 4: 94,863,661 V1013I probably damaging Het
Tg T A 15: 66,735,271 M219K probably benign Het
Tie1 A G 4: 118,486,611 S45P possibly damaging Het
Tmem59 A T 4: 107,190,718 probably benign Het
Togaram1 A T 12: 64,982,450 E882D possibly damaging Het
Tram1l1 T A 3: 124,321,860 M223K possibly damaging Het
Tssk5 C T 15: 76,372,468 R280Q probably benign Het
Uspl1 T A 5: 149,214,595 D669E probably damaging Het
Vav1 C A 17: 57,299,839 probably null Het
Vcl A T 14: 21,014,939 E634V probably benign Het
Zfp672 A T 11: 58,316,455 C347S probably benign Het
Other mutations in Pde8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Pde8b APN 13 95034367 missense probably damaging 1.00
IGL01517:Pde8b APN 13 95100887 critical splice donor site probably null
IGL01736:Pde8b APN 13 95030402 missense probably damaging 1.00
IGL01756:Pde8b APN 13 95046387 missense probably damaging 1.00
IGL01867:Pde8b APN 13 95100938 missense probably damaging 0.99
IGL01939:Pde8b APN 13 95095724 missense probably damaging 0.98
IGL02026:Pde8b APN 13 95034361 missense probably damaging 1.00
IGL02685:Pde8b APN 13 95026120 makesense probably null
IGL02830:Pde8b APN 13 95052901 missense probably benign 0.02
IGL02966:Pde8b APN 13 95095648 missense probably damaging 0.96
IGL03003:Pde8b APN 13 95041957 missense probably damaging 1.00
IGL03064:Pde8b APN 13 95046398 missense probably damaging 1.00
IGL03349:Pde8b APN 13 95043043 splice site probably benign
R0356:Pde8b UTSW 13 95046454 missense probably damaging 0.96
R0464:Pde8b UTSW 13 95104698 missense probably damaging 1.00
R0711:Pde8b UTSW 13 95107817 missense possibly damaging 0.87
R1436:Pde8b UTSW 13 95026170 missense probably benign 0.00
R1467:Pde8b UTSW 13 95034172 missense probably damaging 0.99
R1467:Pde8b UTSW 13 95034172 missense probably damaging 0.99
R1494:Pde8b UTSW 13 95047796 missense probably damaging 1.00
R1546:Pde8b UTSW 13 95046443 missense probably damaging 1.00
R1699:Pde8b UTSW 13 95032866 missense probably damaging 1.00
R1795:Pde8b UTSW 13 95042019 missense probably benign 0.10
R1879:Pde8b UTSW 13 95085215 missense possibly damaging 0.95
R2184:Pde8b UTSW 13 95026215 missense probably damaging 1.00
R2223:Pde8b UTSW 13 95043447 missense probably damaging 1.00
R2892:Pde8b UTSW 13 95034259 missense probably damaging 1.00
R3034:Pde8b UTSW 13 95222767 missense probably damaging 1.00
R4204:Pde8b UTSW 13 95222545 missense probably benign 0.22
R4206:Pde8b UTSW 13 95222545 missense probably benign 0.22
R4711:Pde8b UTSW 13 95030450 missense probably benign 0.00
R5133:Pde8b UTSW 13 95086742 missense probably benign 0.05
R5134:Pde8b UTSW 13 95086742 missense probably benign 0.05
R5314:Pde8b UTSW 13 95086853 missense possibly damaging 0.89
R5342:Pde8b UTSW 13 95041990 missense probably damaging 0.99
R5376:Pde8b UTSW 13 95026146 missense probably benign 0.00
R5806:Pde8b UTSW 13 95042040 missense probably damaging 1.00
R5830:Pde8b UTSW 13 95041890 missense probably benign 0.01
R6021:Pde8b UTSW 13 95026162 missense possibly damaging 0.47
R6035:Pde8b UTSW 13 95027597 intron probably benign
R6035:Pde8b UTSW 13 95027597 intron probably benign
R6129:Pde8b UTSW 13 95041959 missense probably damaging 0.98
R6181:Pde8b UTSW 13 95086808 missense probably benign 0.36
R6313:Pde8b UTSW 13 95042000 nonsense probably null
R6849:Pde8b UTSW 13 95047799 missense possibly damaging 0.89
R6914:Pde8b UTSW 13 95086844 missense probably benign 0.06
R6999:Pde8b UTSW 13 95086834 missense possibly damaging 0.91
R7149:Pde8b UTSW 13 95086841 missense probably benign 0.03
R7275:Pde8b UTSW 13 95042934 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGCCGTCTTGTCAAATTGC -3'
(R):5'- ACTTTCTGGGCCACTGATG -3'

Sequencing Primer
(F):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'
(R):5'- CACTGATGGAACCGGTGTTTG -3'
Posted On2015-09-25