Incidental Mutation 'R4623:Dusp13'
ID346361
Institutional Source Beutler Lab
Gene Symbol Dusp13
Ensembl Gene ENSMUSG00000021768
Gene Namedual specificity phosphatase 13
SynonymsTMDP, TS-DSP6, LMW-DSP6, LOC382853
MMRRC Submission 041888-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4623 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location21733394-21751181 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to C at 21743478 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075040] [ENSMUST00000119866] [ENSMUST00000120956] [ENSMUST00000120984] [ENSMUST00000127851] [ENSMUST00000153071] [ENSMUST00000183698] [ENSMUST00000183893] [ENSMUST00000183943] [ENSMUST00000184571] [ENSMUST00000184703] [ENSMUST00000185042]
Predicted Effect probably benign
Transcript: ENSMUST00000075040
SMART Domains Protein: ENSMUSP00000074553
Gene: ENSMUSG00000021768

DomainStartEndE-ValueType
DSPc 37 181 7.66e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119866
SMART Domains Protein: ENSMUSP00000112552
Gene: ENSMUSG00000021768

DomainStartEndE-ValueType
DSPc 45 190 9.29e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120956
SMART Domains Protein: ENSMUSP00000113305
Gene: ENSMUSG00000021768

DomainStartEndE-ValueType
DSPc 110 255 9.29e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120984
SMART Domains Protein: ENSMUSP00000113985
Gene: ENSMUSG00000021768

DomainStartEndE-ValueType
DSPc 45 190 9.29e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127051
SMART Domains Protein: ENSMUSP00000127910
Gene: ENSMUSG00000021768

DomainStartEndE-ValueType
DSPc 9 142 2.4e-24 SMART
Predicted Effect unknown
Transcript: ENSMUST00000127851
AA Change: L205R
SMART Domains Protein: ENSMUSP00000120977
Gene: ENSMUSG00000021768
AA Change: L205R

DomainStartEndE-ValueType
SCOP:d1vhra_ 20 133 9e-10 SMART
Blast:DSPc 37 129 5e-60 BLAST
PDB:2E0T|A 39 129 1e-26 PDB
low complexity region 162 173 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142076
Predicted Effect probably benign
Transcript: ENSMUST00000153071
SMART Domains Protein: ENSMUSP00000139140
Gene: ENSMUSG00000021768

DomainStartEndE-ValueType
Pfam:DSPc 1 48 5.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183698
SMART Domains Protein: ENSMUSP00000139058
Gene: ENSMUSG00000021768

DomainStartEndE-ValueType
DSPc 68 213 9.29e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183824
Predicted Effect probably benign
Transcript: ENSMUST00000183893
SMART Domains Protein: ENSMUSP00000139061
Gene: ENSMUSG00000021768

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183943
SMART Domains Protein: ENSMUSP00000139154
Gene: ENSMUSG00000021768

DomainStartEndE-ValueType
internal_repeat_1 19 71 6.78e-8 PROSPERO
DSPc 95 240 9.29e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184571
Predicted Effect probably benign
Transcript: ENSMUST00000184703
SMART Domains Protein: ENSMUSP00000138972
Gene: ENSMUSG00000021768

DomainStartEndE-ValueType
DSPc 45 190 9.29e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185042
Meta Mutation Damage Score 0.6432 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: Members of the protein-tyrosine phosphatase superfamily cooperate with protein kinases to regulate cell proliferation and differentiation. This superfamily is separated into two families based on the substrate that is dephosphorylated. One family, the dual specificity phosphatases (DSPs) acts on both phosphotyrosine and phosphoserine/threonine residues. This gene encodes different but related DSP proteins through the use of non-overlapping open reading frames, alternate splicing, and presumed different transcription promoters. Expression of the distinct proteins from this gene has been found to be tissue specific and the proteins may be involved in postnatal development of specific tissues. A protein encoded by the upstream ORF was found in skeletal muscle, whereas the encoded protein from the downstream ORF was found only in testis. In humans, a similar pattern of expression was found. Multiple alternatively spliced transcript variants were described, but the full-length sequence of only some were determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik T C 9: 94,520,398 N404D possibly damaging Het
1700034J04Rik T C 12: 11,222,140 noncoding transcript Het
A930003A15Rik C T 16: 19,883,737 noncoding transcript Het
Abca13 A G 11: 9,309,130 Y2952C probably damaging Het
Actrt2 T C 4: 154,667,290 T130A probably benign Het
Adamts7 T A 9: 90,186,462 D475E probably benign Het
Adgrf5 A G 17: 43,450,983 S1190G probably benign Het
Adgrg6 A T 10: 14,441,499 C526S probably damaging Het
Aldoc T C 11: 78,325,121 V151A probably damaging Het
Arsj A T 3: 126,364,796 E8V probably benign Het
Asph T C 4: 9,622,005 K167E possibly damaging Het
Auts2 G A 5: 131,440,383 P475S probably benign Het
C1d A G 11: 17,262,742 D29G possibly damaging Het
Calb1 T A 4: 15,895,721 probably benign Het
Ceacam15 A T 7: 16,673,466 F42Y probably damaging Het
Cpm A G 10: 117,670,297 N188D possibly damaging Het
Cts6 A T 13: 61,202,160 Y36N possibly damaging Het
Cux1 T C 5: 136,308,300 K657R probably damaging Het
Cyp2a22 G T 7: 26,933,491 P429T probably damaging Het
Dock3 T C 9: 107,062,045 E168G possibly damaging Het
Dot1l A G 10: 80,782,150 N324S probably benign Het
Eif4g1 T A 16: 20,681,345 probably benign Het
Fan1 G T 7: 64,373,553 Y121* probably null Het
Foxn4 T C 5: 114,260,930 E80G possibly damaging Het
Gal3st2c C A 1: 94,009,456 H374Q possibly damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm973 A T 1: 59,556,276 I409F probably damaging Het
Gpr18 T A 14: 121,912,167 T149S probably damaging Het
Gsr A G 8: 33,680,305 E206G probably damaging Het
Hal A G 10: 93,507,439 H515R probably damaging Het
Heatr5b A G 17: 78,795,119 S1277P possibly damaging Het
Hmcn2 A G 2: 31,396,710 E2125G probably damaging Het
Ikzf4 A G 10: 128,641,119 C108R probably damaging Het
Kcnh2 A G 5: 24,348,442 V59A probably benign Het
Khdrbs1 A G 4: 129,720,842 V306A probably benign Het
Kif11 A T 19: 37,409,747 I674L probably benign Het
Lrp1b A T 2: 41,246,021 C1646S probably damaging Het
Ltbp2 A G 12: 84,809,348 I707T probably damaging Het
Macf1 A G 4: 123,372,348 probably null Het
Mib1 C A 18: 10,808,086 N944K probably benign Het
Mical3 C A 6: 120,961,625 E262* probably null Het
Mms22l C T 4: 24,502,792 Q55* probably null Het
Mrps11 T C 7: 78,791,941 probably null Het
Myh8 A G 11: 67,286,258 E412G probably damaging Het
Myo9a T A 9: 59,871,072 D1370E probably benign Het
Ncapd2 A G 6: 125,173,609 V843A probably benign Het
Nell1 A G 7: 50,120,562 E123G possibly damaging Het
Nkd1 A G 8: 88,589,755 D213G probably benign Het
Nlrp1b T C 11: 71,161,843 T920A probably benign Het
Olfr1090 T A 2: 86,754,562 M59L possibly damaging Het
Olfr175-ps1 A T 16: 58,824,106 I201N possibly damaging Het
Olfr784 G A 10: 129,388,046 V138M probably benign Het
Pde8b C T 13: 95,041,939 A566T possibly damaging Het
Pds5b T A 5: 150,800,601 S1214R probably benign Het
Pld1 T C 3: 28,029,244 I171T probably benign Het
Plekha5 T A 6: 140,551,186 V154E probably damaging Het
Plxna2 A T 1: 194,812,150 I1892L probably benign Het
Ppp1r16b A G 2: 158,761,463 Y436C possibly damaging Het
Proc T A 18: 32,127,473 T200S probably benign Het
Psap T G 10: 60,300,851 C536W probably damaging Het
Ptger2 G A 14: 44,989,014 R17H possibly damaging Het
Rab42 A G 4: 132,303,193 F49L possibly damaging Het
Racgap1 C A 15: 99,626,206 S440I probably benign Het
Rdh10 G A 1: 16,131,063 probably benign Het
Rnft2 T A 5: 118,232,406 S244C probably damaging Het
Sftpc T C 14: 70,522,278 probably null Het
Shcbp1 A C 8: 4,739,178 V547G probably damaging Het
Slc6a13 T C 6: 121,325,145 S229P probably damaging Het
Soat2 A T 15: 102,157,709 probably benign Het
Swap70 A G 7: 110,267,872 K294E probably benign Het
Tcim C A 8: 24,438,709 R63L probably damaging Het
Tek G A 4: 94,863,661 V1013I probably damaging Het
Tg T A 15: 66,735,271 M219K probably benign Het
Tie1 A G 4: 118,486,611 S45P possibly damaging Het
Tmem59 A T 4: 107,190,718 probably benign Het
Togaram1 A T 12: 64,982,450 E882D possibly damaging Het
Tram1l1 T A 3: 124,321,860 M223K possibly damaging Het
Tssk5 C T 15: 76,372,468 R280Q probably benign Het
Uspl1 T A 5: 149,214,595 D669E probably damaging Het
Vav1 C A 17: 57,299,839 probably null Het
Vcl A T 14: 21,014,939 E634V probably benign Het
Zfp672 A T 11: 58,316,455 C347S probably benign Het
Other mutations in Dusp13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01803:Dusp13 APN 14 21733839 missense probably damaging 1.00
IGL02963:Dusp13 APN 14 21733807 missense possibly damaging 0.86
R0827:Dusp13 UTSW 14 21742771 missense probably benign
R1185:Dusp13 UTSW 14 21735018 missense probably damaging 1.00
R1185:Dusp13 UTSW 14 21735018 missense probably damaging 1.00
R1185:Dusp13 UTSW 14 21735018 missense probably damaging 1.00
R1882:Dusp13 UTSW 14 21734975 missense probably benign 0.04
R2915:Dusp13 UTSW 14 21740137 missense probably damaging 1.00
R3954:Dusp13 UTSW 14 21740107 missense probably damaging 1.00
R4837:Dusp13 UTSW 14 21743525 utr 3 prime probably benign
R6713:Dusp13 UTSW 14 21748473 missense probably damaging 1.00
R7294:Dusp13 UTSW 14 21733714 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- CTACCTCTGACCCATTTGGAG -3'
(R):5'- AGGATAGGTTTGGGCCTCAG -3'

Sequencing Primer
(F):5'- TTTGGAGTCCCCCAACCCAG -3'
(R):5'- TGGGTACAGTTGCACAGC -3'
Posted On2015-09-25