Incidental Mutation 'R4624:Fer1l6'
ID346448
Institutional Source Beutler Lab
Gene Symbol Fer1l6
Ensembl Gene ENSMUSG00000037106
Gene Namefer-1-like 6 (C. elegans)
SynonymsEG631797
MMRRC Submission 041889-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R4624 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location58510048-58665092 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58553705 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 144 (I144T)
Ref Sequence ENSEMBL: ENSMUSP00000125718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161028]
Predicted Effect probably damaging
Transcript: ENSMUST00000161028
AA Change: I144T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125718
Gene: ENSMUSG00000037106
AA Change: I144T

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
C2 83 179 4.09e-12 SMART
FerI 165 235 2.06e-36 SMART
C2 243 354 5.19e-14 SMART
low complexity region 412 449 N/A INTRINSIC
FerB 714 787 2.53e-45 SMART
C2 829 936 8.84e-8 SMART
C2 1000 1099 3.05e0 SMART
low complexity region 1189 1203 N/A INTRINSIC
low complexity region 1256 1270 N/A INTRINSIC
C2 1361 1460 5.78e-12 SMART
low complexity region 1518 1529 N/A INTRINSIC
C2 1601 1731 1.01e-2 SMART
Pfam:Ferlin_C 1765 1857 2.3e-40 PFAM
Meta Mutation Damage Score 0.138 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 93% (85/91)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730409E04Rik A G 4: 126,612,080 T134A possibly damaging Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
Adgb C A 10: 10,403,004 V267L probably benign Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd52 A G 10: 128,389,259 H863R probably damaging Het
Ap3b1 A G 13: 94,483,226 R766G unknown Het
Apol7c A G 15: 77,526,395 F117S probably damaging Het
Bcr A T 10: 75,153,920 E716V probably damaging Het
Borcs6 T C 11: 69,060,597 L267P probably damaging Het
Ccdc184 A T 15: 98,168,757 N148Y probably benign Het
Ccdc50 A G 16: 27,436,601 K223R probably null Het
Cd2 T G 3: 101,287,431 K114Q probably benign Het
Cdh19 T C 1: 110,932,251 K167E probably benign Het
Cep131 T C 11: 120,070,832 E558G probably damaging Het
Cmya5 A T 13: 93,063,551 V3423E probably damaging Het
Cnot6l A G 5: 96,077,211 V541A probably benign Het
Cntn5 A T 9: 9,704,804 C663* probably null Het
Dnah12 T C 14: 26,735,758 I893T possibly damaging Het
Dopey1 G A 9: 86,521,525 V129M probably damaging Het
Dyx1c1 A G 9: 72,964,171 I238V probably benign Het
Exoc6b A G 6: 84,854,809 probably benign Het
Ext2 A G 2: 93,703,200 V671A probably benign Het
Fcamr T G 1: 130,803,262 L28R probably damaging Het
Frem1 A G 4: 82,989,106 L839P probably damaging Het
Fscn2 A T 11: 120,367,343 I364F probably benign Het
Gm10291 T C 3: 78,917,274 noncoding transcript Het
Gm29125 T C 1: 80,384,959 noncoding transcript Het
Grin2b T C 6: 135,733,825 M908V probably damaging Het
Helz2 T C 2: 181,239,308 E436G probably damaging Het
Hfe A T 13: 23,706,078 C149* probably null Het
Hs1bp3 T C 12: 8,336,357 V253A probably benign Het
Kat14 A G 2: 144,404,220 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnh3 T A 15: 99,226,372 D47E probably damaging Het
Kcp A G 6: 29,482,814 F1419L possibly damaging Het
Kera A G 10: 97,609,631 N284S probably benign Het
Klhl24 A G 16: 20,120,123 D476G probably damaging Het
Krt79 T A 15: 101,939,806 T137S possibly damaging Het
Lilrb4a A G 10: 51,491,488 Y42C probably damaging Het
Lnx1 C T 5: 74,660,460 probably benign Het
Map3k14 A G 11: 103,231,101 Y497H probably damaging Het
Mut G A 17: 40,947,055 E371K probably damaging Het
Nkx2-6 A G 14: 69,174,926 Q181R probably damaging Het
Notch1 T C 2: 26,478,081 K631R possibly damaging Het
Olfr1436 C T 19: 12,298,983 V50I probably benign Het
Pcdh9 T A 14: 93,886,409 N775I probably damaging Het
Phkb T A 8: 85,848,712 probably benign Het
Pick1 T A 15: 79,246,466 I250N probably damaging Het
Plec T C 15: 76,175,135 E3556G probably damaging Het
Prex2 C T 1: 11,289,265 Q1566* probably null Het
Ptgr2 T G 12: 84,308,354 F287L possibly damaging Het
Ptprv T C 1: 135,124,131 noncoding transcript Het
Rab5b G T 10: 128,683,261 H83Q probably benign Het
Ranbp6 A T 19: 29,810,863 Y696* probably null Het
Rapgef3 G T 15: 97,758,929 D318E probably damaging Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Rsrc1 T C 3: 67,349,978 V241A probably damaging Het
Ryr2 A T 13: 12,106,415 I11N possibly damaging Het
S100a11 T C 3: 93,526,014 L55P probably damaging Het
Sec13 A G 6: 113,729,691 S254P probably benign Het
Slc25a36 G A 9: 97,079,125 T147I probably damaging Het
Spata31d1c A G 13: 65,036,597 E651G probably benign Het
Stox2 C A 8: 47,193,816 R203L probably damaging Het
Tbc1d30 A T 10: 121,296,786 D224E probably damaging Het
Tdrd6 A G 17: 43,625,990 L1389P probably damaging Het
Tmprss11b T C 5: 86,665,036 S134G probably benign Het
Tmtc2 A T 10: 105,303,650 S672T probably benign Het
Tnnt1 G A 7: 4,512,268 probably benign Het
Tpst2 A G 5: 112,308,296 M234V probably damaging Het
Ttbk2 T C 2: 120,773,323 D208G probably benign Het
Ube2c A G 2: 164,772,173 N143S possibly damaging Het
Unc45b T A 11: 82,926,009 M425K probably benign Het
Uvssa G A 5: 33,389,956 E289K possibly damaging Het
Vmn2r11 T A 5: 109,052,235 R451W probably damaging Het
Vmn2r45 T C 7: 8,481,342 Y488C probably damaging Het
Vmn2r55 T A 7: 12,670,700 I259F possibly damaging Het
Wdfy3 C T 5: 101,884,083 R2277Q possibly damaging Het
Wdr64 T G 1: 175,772,263 M111R probably benign Het
Other mutations in Fer1l6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0009:Fer1l6 UTSW 15 58662787 missense probably damaging 1.00
R0141:Fer1l6 UTSW 15 58558402 missense probably damaging 1.00
R0178:Fer1l6 UTSW 15 58637914 splice site probably null
R0304:Fer1l6 UTSW 15 58590562 missense probably benign 0.08
R0379:Fer1l6 UTSW 15 58548338 missense probably benign 0.05
R0457:Fer1l6 UTSW 15 58638094 critical splice donor site probably null
R0546:Fer1l6 UTSW 15 58558408 splice site probably null
R0602:Fer1l6 UTSW 15 58577945 missense probably damaging 0.98
R0619:Fer1l6 UTSW 15 58662935 unclassified probably null
R0669:Fer1l6 UTSW 15 58553724 splice site probably null
R0854:Fer1l6 UTSW 15 58559188 missense probably benign 0.00
R0948:Fer1l6 UTSW 15 58564075 missense probably benign 0.00
R1180:Fer1l6 UTSW 15 58602311 splice site probably benign
R1483:Fer1l6 UTSW 15 58637970 missense possibly damaging 0.84
R1627:Fer1l6 UTSW 15 58641879 missense probably benign 0.41
R1635:Fer1l6 UTSW 15 58647081 missense probably damaging 1.00
R1834:Fer1l6 UTSW 15 58557869 missense possibly damaging 0.58
R1921:Fer1l6 UTSW 15 58625231 missense probably damaging 1.00
R2000:Fer1l6 UTSW 15 58602311 splice site probably benign
R2041:Fer1l6 UTSW 15 58558306 missense probably damaging 1.00
R2144:Fer1l6 UTSW 15 58627534 missense probably benign
R2145:Fer1l6 UTSW 15 58627534 missense probably benign
R2981:Fer1l6 UTSW 15 58564077 missense probably damaging 0.99
R4164:Fer1l6 UTSW 15 58559238 missense possibly damaging 0.83
R4192:Fer1l6 UTSW 15 58647149 missense probably damaging 1.00
R4273:Fer1l6 UTSW 15 58627522 missense probably benign 0.41
R4573:Fer1l6 UTSW 15 58626280 critical splice donor site probably null
R4581:Fer1l6 UTSW 15 58640226 missense probably damaging 1.00
R4755:Fer1l6 UTSW 15 58640211 missense probably benign 0.09
R4774:Fer1l6 UTSW 15 58577949 missense probably damaging 0.99
R4894:Fer1l6 UTSW 15 58618902 missense probably damaging 1.00
R4896:Fer1l6 UTSW 15 58638020 missense probably damaging 1.00
R4921:Fer1l6 UTSW 15 58600311 critical splice acceptor site probably null
R4962:Fer1l6 UTSW 15 58571401 missense probably benign 0.03
R5029:Fer1l6 UTSW 15 58643920 missense probably benign 0.00
R5134:Fer1l6 UTSW 15 58640154 missense probably damaging 1.00
R5175:Fer1l6 UTSW 15 58550277 missense probably damaging 1.00
R5227:Fer1l6 UTSW 15 58581903 nonsense probably null
R5561:Fer1l6 UTSW 15 58660825 missense probably damaging 0.97
R5621:Fer1l6 UTSW 15 58558326 missense probably damaging 1.00
R5670:Fer1l6 UTSW 15 58622482 missense probably benign 0.00
R5745:Fer1l6 UTSW 15 58571389 missense probably benign 0.01
R5807:Fer1l6 UTSW 15 58590550 nonsense probably null
R5823:Fer1l6 UTSW 15 58590503 nonsense probably null
R5892:Fer1l6 UTSW 15 58564068 missense probably benign
R6006:Fer1l6 UTSW 15 58647044 missense probably damaging 1.00
R6137:Fer1l6 UTSW 15 58559206 missense probably damaging 0.97
R6195:Fer1l6 UTSW 15 58637957 missense probably damaging 1.00
R6234:Fer1l6 UTSW 15 58560639 missense probably damaging 1.00
R6237:Fer1l6 UTSW 15 58625177 nonsense probably null
R6237:Fer1l6 UTSW 15 58638006 missense probably damaging 1.00
R6271:Fer1l6 UTSW 15 58641918 missense probably benign 0.01
R6336:Fer1l6 UTSW 15 58559232 nonsense probably null
R6784:Fer1l6 UTSW 15 58571426 missense possibly damaging 0.63
R6852:Fer1l6 UTSW 15 58594878 missense probably damaging 1.00
R7030:Fer1l6 UTSW 15 58629378 missense probably damaging 1.00
R7088:Fer1l6 UTSW 15 58564050 missense possibly damaging 0.69
R7181:Fer1l6 UTSW 15 58575297 missense probably benign 0.00
R7226:Fer1l6 UTSW 15 58590535 missense probably benign 0.00
R7266:Fer1l6 UTSW 15 58627597 missense probably benign
R7463:Fer1l6 UTSW 15 58573601 nonsense probably null
R7483:Fer1l6 UTSW 15 58641945 missense possibly damaging 0.83
R7491:Fer1l6 UTSW 15 58600432 missense probably damaging 1.00
R7534:Fer1l6 UTSW 15 58638026 missense probably damaging 1.00
R7562:Fer1l6 UTSW 15 58560482 missense probably benign 0.00
X0021:Fer1l6 UTSW 15 58569202 nonsense probably null
X0027:Fer1l6 UTSW 15 58629340 missense probably damaging 1.00
X0063:Fer1l6 UTSW 15 58618574 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGAATGTAGTTGCTGGC -3'
(R):5'- CTGTGTCCTAAAGTCCTCCATATTG -3'

Sequencing Primer
(F):5'- AAGAATGTAGTTGCTGGCATTTTATG -3'
(R):5'- GGGGATTTTTCAGCTTTAGCCC -3'
Posted On2015-09-25