Incidental Mutation 'R0256:Fhl5'
ID34734
Institutional Source Beutler Lab
Gene Symbol Fhl5
Ensembl Gene ENSMUSG00000028259
Gene Namefour and a half LIM domains 5
SynonymsACT, 1700027G07Rik
MMRRC Submission 038487-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R0256 (G1)
Quality Score135
Status Validated
Chromosome4
Chromosomal Location25199908-25242876 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25213624 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 104 (H104R)
Ref Sequence ENSEMBL: ENSMUSP00000103839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029922] [ENSMUST00000108204]
Predicted Effect probably benign
Transcript: ENSMUST00000029922
AA Change: H104R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029922
Gene: ENSMUSG00000028259
AA Change: H104R

DomainStartEndE-ValueType
LIM 40 93 1.91e-11 SMART
LIM 101 154 4.59e-14 SMART
LIM 162 213 3.7e-9 SMART
LIM 221 276 7.68e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108204
AA Change: H104R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103839
Gene: ENSMUSG00000028259
AA Change: H104R

DomainStartEndE-ValueType
LIM 40 93 1.91e-11 SMART
LIM 101 154 4.59e-14 SMART
LIM 162 213 3.7e-9 SMART
LIM 221 276 7.68e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124792
Meta Mutation Damage Score 0.12 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.6%
  • 10x: 95.8%
  • 20x: 92.8%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is coordinately expressed with activator of cAMP-responsive element modulator (CREM). It is associated with CREM and confers a powerful transcriptional activation function. CREM acts as a transcription factor essential for the differentiation of spermatids into mature spermatozoa. There are multiple polyadenylation sites found in this gene. Polymorphisms in this gene may be associated with susceptibility for migraine headaches. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Apr 2016]
PHENOTYPE: Male mice homozygous for disruptions of this gene have reduced sperm counts and abnormal sperm but are none the less fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G T 3: 36,917,773 V552L probably benign Het
9330159F19Rik G T 10: 29,222,256 L186F probably damaging Het
Abce1 A C 8: 79,685,943 probably null Het
Acvrl1 A T 15: 101,137,121 N254Y probably damaging Het
Apip T A 2: 103,088,571 M72K possibly damaging Het
Arg1 A G 10: 24,916,458 Y188H probably benign Het
Armc3 A T 2: 19,269,216 N354Y probably damaging Het
Arrdc5 A G 17: 56,294,382 F248L probably damaging Het
Atp8b5 T C 4: 43,302,576 probably benign Het
Ccdc154 C T 17: 25,170,632 A490V probably benign Het
Cdh6 T C 15: 13,053,782 probably benign Het
Chmp2b G T 16: 65,540,192 T193K probably benign Het
Clca3a1 A T 3: 144,730,879 N814K probably damaging Het
Cmtr1 T C 17: 29,697,124 L576P probably damaging Het
Foxk1 A G 5: 142,453,681 probably benign Het
Gm11596 T A 11: 99,792,716 T193S unknown Het
Gm15217 A T 14: 46,380,396 probably benign Het
Hic2 A G 16: 17,257,513 I69V probably benign Het
Ivl T C 3: 92,571,843 D305G probably damaging Het
Kcnn2 A G 18: 45,592,405 T323A probably damaging Het
Krt7 C T 15: 101,423,309 Q336* probably null Het
Krt73 T G 15: 101,801,936 D121A probably damaging Het
Mok T C 12: 110,808,105 D216G probably damaging Het
Muc3 A G 5: 137,146,691 C44R probably damaging Het
Muc5b A G 7: 141,841,395 Y46C unknown Het
Muc5b T C 7: 141,843,258 F223L unknown Het
Noct A G 3: 51,250,474 D411G probably damaging Het
Olfr1106 T C 2: 87,049,056 Y60C probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr813 A T 10: 129,857,037 D173V probably damaging Het
Pigv T C 4: 133,665,751 H36R probably damaging Het
Plscr3 A G 11: 69,850,054 K239E probably damaging Het
Prkag3 T C 1: 74,741,171 D445G probably benign Het
Ramp1 A T 1: 91,196,919 probably benign Het
Ror1 T A 4: 100,409,745 H214Q probably benign Het
Selenbp2 A T 3: 94,699,701 H156L probably benign Het
Slc28a3 T C 13: 58,573,500 T284A probably benign Het
Slc35a1 T C 4: 34,668,962 T284A probably benign Het
Smco2 A T 6: 146,861,746 I184F probably damaging Het
Son A G 16: 91,656,584 M740V possibly damaging Het
Stil T A 4: 115,023,685 N475K possibly damaging Het
Sval3 A G 6: 41,972,905 D122G probably damaging Het
Tnks A G 8: 34,861,547 M623T probably benign Het
Zfp142 A G 1: 74,578,158 V235A probably benign Het
Zfp423 A T 8: 87,773,634 C1053* probably null Het
Zfp648 T A 1: 154,205,668 D524E probably benign Het
Other mutations in Fhl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Fhl5 APN 4 25207181 missense possibly damaging 0.95
IGL02194:Fhl5 APN 4 25211341 missense probably benign 0.01
IGL03172:Fhl5 APN 4 25211309 missense probably damaging 1.00
PIT4466001:Fhl5 UTSW 4 25211194 missense probably damaging 1.00
PIT4472001:Fhl5 UTSW 4 25211194 missense probably damaging 1.00
R0020:Fhl5 UTSW 4 25200054 missense probably benign 0.15
R0020:Fhl5 UTSW 4 25200054 missense probably benign 0.15
R0304:Fhl5 UTSW 4 25207241 missense probably benign 0.01
R0480:Fhl5 UTSW 4 25207101 nonsense probably null
R0563:Fhl5 UTSW 4 25213610 missense probably damaging 0.96
R3418:Fhl5 UTSW 4 25211252 missense probably benign
R3926:Fhl5 UTSW 4 25214790 splice site probably benign
R4382:Fhl5 UTSW 4 25200118 missense probably benign 0.16
R5930:Fhl5 UTSW 4 25214756 missense probably benign 0.04
R6135:Fhl5 UTSW 4 25214716 nonsense probably null
R6927:Fhl5 UTSW 4 25213681 missense probably benign 0.14
R7147:Fhl5 UTSW 4 25213777 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACCACTGATTATGCCCAAGGCAGG -3'
(R):5'- GCACTAGGTTCCCAAGAATGTCCC -3'

Sequencing Primer
(F):5'- GCAGAGCACCATCATTTATGTG -3'
(R):5'- GTCCCATCTTGTCTTAGAAAACAGC -3'
Posted On2013-05-09