Incidental Mutation 'R4670:Olfr231'
ID348340
Institutional Source Beutler Lab
Gene Symbol Olfr231
Ensembl Gene ENSMUSG00000046486
Gene Nameolfactory receptor 231
SynonymsOlfr244, GA_x6K02T2LER7-6-623, Olfr425, GA_x6K02T2P20D-21053942-21054499, GA_x6K02T02K39-452-3, MOR105-4
MMRRC Submission 041926-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R4670 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location174113211-174121162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 174117861 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 52 (M52L)
Ref Sequence ENSEMBL: ENSMUSP00000151011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063030] [ENSMUST00000214446]
Predicted Effect probably benign
Transcript: ENSMUST00000063030
AA Change: M52L

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000059596
Gene: ENSMUSG00000046486
AA Change: M52L

DomainStartEndE-ValueType
Pfam:7tm_4 24 300 2.6e-63 PFAM
Pfam:7tm_1 34 282 2.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214446
AA Change: M52L

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.1112 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm5 T A 7: 119,531,760 probably null Het
Alb T A 5: 90,462,806 S82T probably benign Het
Arf4 A G 14: 26,653,093 probably benign Het
Arhgap22 T C 14: 33,362,543 C260R probably damaging Het
Arhgap32 A G 9: 32,170,145 E153G probably benign Het
Arhgef18 T A 8: 3,434,897 M200K probably damaging Het
Atp1a4 T A 1: 172,235,000 N647Y probably benign Het
Atp5c1 A T 2: 10,059,617 L226Q probably damaging Het
Bcas1 T C 2: 170,384,325 K310R probably damaging Het
Cadm3 T A 1: 173,346,446 T67S probably damaging Het
Cartpt C T 13: 99,900,080 probably null Het
Cenpj A T 14: 56,553,383 V403E possibly damaging Het
Chst7 C A X: 20,060,871 R386S probably damaging Het
Cyp4f37 A T 17: 32,625,152 M77L probably benign Het
Dnah7b A T 1: 46,078,524 D50V probably damaging Het
Galnt4 A G 10: 99,109,298 D295G possibly damaging Het
Gin1 C T 1: 97,784,840 P154S probably damaging Het
Gm6471 G A 7: 142,831,623 noncoding transcript Het
Gm6818 T A 7: 38,402,557 noncoding transcript Het
Gm9271 T A 7: 39,364,310 noncoding transcript Het
Gpam A G 19: 55,096,119 probably null Het
Gpr183 T C 14: 121,954,737 D124G probably damaging Het
Ift140 C A 17: 25,098,961 probably benign Het
Itih5 A C 2: 10,190,369 I191L probably benign Het
Jcad A G 18: 4,674,175 T646A probably benign Het
Kank1 T C 19: 25,410,580 M511T probably benign Het
Krt74 A T 15: 101,758,869 noncoding transcript Het
Lrrc37a A G 11: 103,504,537 S21P probably benign Het
Lrrc8c G A 5: 105,608,374 V672I probably benign Het
Lypd4 T C 7: 24,866,726 R58G probably benign Het
Magi1 A T 6: 93,686,643 probably null Het
Mefv T A 16: 3,708,207 L745F possibly damaging Het
Myh13 A T 11: 67,364,738 K1645* probably null Het
Naip6 A G 13: 100,294,731 probably null Het
Nlrp1c-ps T C 11: 71,280,556 noncoding transcript Het
Nsmce3 A T 7: 64,872,782 L46Q probably benign Het
Olfr1084 T C 2: 86,639,168 D180G possibly damaging Het
Olfr612 A G 7: 103,539,186 V16A possibly damaging Het
P2ry12 T C 3: 59,217,904 probably null Het
Pcx T A 19: 4,619,888 V861E probably damaging Het
Pkp3 C T 7: 141,082,699 P75S probably benign Het
Plscr4 T C 9: 92,482,867 probably null Het
Pole A G 5: 110,306,387 T923A probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Rhot2 A C 17: 25,841,331 probably benign Het
Rsrp1 A G 4: 134,924,177 Y84C unknown Het
Sbf2 T C 7: 110,335,399 K1348E probably damaging Het
Sgip1 A T 4: 102,869,754 N53Y probably damaging Het
Snapc2 A G 8: 4,254,998 T127A possibly damaging Het
Snx8 A G 5: 140,355,958 probably null Het
Spag8 A G 4: 43,653,378 probably benign Het
Srebf2 T C 15: 82,192,302 F718L probably damaging Het
Szt2 C G 4: 118,375,829 probably benign Het
Traf3ip2 C T 10: 39,639,260 P345S possibly damaging Het
Tubgcp4 T A 2: 121,173,665 Y62* probably null Het
Usp29 T A 7: 6,962,915 S586T possibly damaging Het
Vasp T C 7: 19,264,425 N108S probably benign Het
Vmn1r214 A G 13: 23,034,971 M212V probably benign Het
Wipi2 G C 5: 142,659,590 A194P probably benign Het
Zbtb4 T A 11: 69,776,529 I220N probably damaging Het
Zcchc2 A T 1: 105,990,266 probably benign Het
Zfp729a T A 13: 67,621,415 K232* probably null Het
Zfp995 A T 17: 21,887,339 M1K probably null Het
Other mutations in Olfr231
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01973:Olfr231 APN 1 174117533 missense probably damaging 1.00
IGL03126:Olfr231 APN 1 174117710 missense probably benign 0.07
R0200:Olfr231 UTSW 1 174117512 missense probably benign 0.00
R1292:Olfr231 UTSW 1 174117854 missense probably benign 0.16
R1966:Olfr231 UTSW 1 174117251 nonsense probably null
R2860:Olfr231 UTSW 1 174117732 missense probably damaging 1.00
R2861:Olfr231 UTSW 1 174117732 missense probably damaging 1.00
R2862:Olfr231 UTSW 1 174117732 missense probably damaging 1.00
R4492:Olfr231 UTSW 1 174117204 missense probably benign 0.01
R4594:Olfr231 UTSW 1 174117320 missense probably damaging 0.96
R4703:Olfr231 UTSW 1 174117398 missense possibly damaging 0.52
R6385:Olfr231 UTSW 1 174117296 missense probably damaging 1.00
R7085:Olfr231 UTSW 1 174117660 missense probably damaging 1.00
Z1088:Olfr231 UTSW 1 174117315 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TGTCAGGACACAGCCTTCTG -3'
(R):5'- AAATTCCAGGAAGTCCCTTATGTC -3'

Sequencing Primer
(F):5'- TTCTGTGATACCCAACGAGTG -3'
(R):5'- TTACCTTCACAGATGACCCAATTGG -3'
Posted On2015-10-08