Incidental Mutation 'R4670:P2ry12'
ID348345
Institutional Source Beutler Lab
Gene Symbol P2ry12
Ensembl Gene ENSMUSG00000036353
Gene Namepurinergic receptor P2Y, G-protein coupled 12
Synonyms2900079B22Rik, P2Y12, 4921504D23Rik
MMRRC Submission 041926-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R4670 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location59216272-59262871 bp(-) (GRCm38)
Type of Mutationunclassified (1 bp from exon)
DNA Base Change (assembly) T to C at 59217904 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040325] [ENSMUST00000050360] [ENSMUST00000164225] [ENSMUST00000170388] [ENSMUST00000196583] [ENSMUST00000199609] [ENSMUST00000199659] [ENSMUST00000199675]
Predicted Effect probably benign
Transcript: ENSMUST00000040325
SMART Domains Protein: ENSMUSP00000042269
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 730 2.6e-207 PFAM
low complexity region 744 758 N/A INTRINSIC
low complexity region 853 872 N/A INTRINSIC
low complexity region 1455 1466 N/A INTRINSIC
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1769 1783 N/A INTRINSIC
Pfam:Med12-PQL 1803 2029 2.3e-14 PFAM
low complexity region 2055 2076 N/A INTRINSIC
low complexity region 2083 2101 N/A INTRINSIC
low complexity region 2116 2136 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000050360
AA Change: S117G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051353
Gene: ENSMUSG00000036353
AA Change: S117G

DomainStartEndE-ValueType
Pfam:7tm_1 48 304 1.3e-40 PFAM
low complexity region 322 335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164225
SMART Domains Protein: ENSMUSP00000127038
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 283 765 5e-187 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1763 1777 N/A INTRINSIC
low complexity region 1804 1818 N/A INTRINSIC
Pfam:Med12-PQL 1840 2063 9.7e-66 PFAM
low complexity region 2090 2111 N/A INTRINSIC
low complexity region 2118 2136 N/A INTRINSIC
low complexity region 2151 2171 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170388
AA Change: S117G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126819
Gene: ENSMUSG00000036353
AA Change: S117G

DomainStartEndE-ValueType
Pfam:7tm_1 23 304 1.5e-31 PFAM
low complexity region 322 335 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196583
AA Change: S117G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143036
Gene: ENSMUSG00000036353
AA Change: S117G

DomainStartEndE-ValueType
Pfam:7tm_1 48 304 1.3e-40 PFAM
low complexity region 322 335 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199609
AA Change: S117G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143521
Gene: ENSMUSG00000036353
AA Change: S117G

DomainStartEndE-ValueType
Pfam:7tm_1 23 304 1.5e-31 PFAM
low complexity region 322 335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199659
SMART Domains Protein: ENSMUSP00000142903
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 765 5.5e-209 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1761 1775 N/A INTRINSIC
low complexity region 1802 1816 N/A INTRINSIC
Pfam:Med12-PQL 1836 2062 1.7e-15 PFAM
low complexity region 2088 2130 N/A INTRINSIC
low complexity region 2144 2164 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000199675
SMART Domains Protein: ENSMUSP00000143706
Gene: ENSMUSG00000036353

DomainStartEndE-ValueType
PDB:4PY0|A 2 116 5e-59 PDB
SCOP:d1l9ha_ 3 116 8e-9 SMART
Meta Mutation Damage Score 0.046 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor is involved in platelet aggregation, and is a potential target for the treatment of thromboembolisms and other clotting disorders. Mutations in this gene are implicated in bleeding disorder, platelet type 8 (BDPLT8). Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous mutation of this gene results in impaired platelet activation, increased bleeding time and delayed thrombus formation in injured arteries. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm5 T A 7: 119,531,760 probably null Het
Alb T A 5: 90,462,806 S82T probably benign Het
Arf4 A G 14: 26,653,093 probably benign Het
Arhgap22 T C 14: 33,362,543 C260R probably damaging Het
Arhgap32 A G 9: 32,170,145 E153G probably benign Het
Arhgef18 T A 8: 3,434,897 M200K probably damaging Het
Atp1a4 T A 1: 172,235,000 N647Y probably benign Het
Atp5c1 A T 2: 10,059,617 L226Q probably damaging Het
Bcas1 T C 2: 170,384,325 K310R probably damaging Het
Cadm3 T A 1: 173,346,446 T67S probably damaging Het
Cartpt C T 13: 99,900,080 probably null Het
Cenpj A T 14: 56,553,383 V403E possibly damaging Het
Chst7 C A X: 20,060,871 R386S probably damaging Het
Cyp4f37 A T 17: 32,625,152 M77L probably benign Het
Dnah7b A T 1: 46,078,524 D50V probably damaging Het
Galnt4 A G 10: 99,109,298 D295G possibly damaging Het
Gin1 C T 1: 97,784,840 P154S probably damaging Het
Gm6471 G A 7: 142,831,623 noncoding transcript Het
Gm6818 T A 7: 38,402,557 noncoding transcript Het
Gm9271 T A 7: 39,364,310 noncoding transcript Het
Gpam A G 19: 55,096,119 probably null Het
Gpr183 T C 14: 121,954,737 D124G probably damaging Het
Ift140 C A 17: 25,098,961 probably benign Het
Itih5 A C 2: 10,190,369 I191L probably benign Het
Jcad A G 18: 4,674,175 T646A probably benign Het
Kank1 T C 19: 25,410,580 M511T probably benign Het
Krt74 A T 15: 101,758,869 noncoding transcript Het
Lrrc37a A G 11: 103,504,537 S21P probably benign Het
Lrrc8c G A 5: 105,608,374 V672I probably benign Het
Lypd4 T C 7: 24,866,726 R58G probably benign Het
Magi1 A T 6: 93,686,643 probably null Het
Mefv T A 16: 3,708,207 L745F possibly damaging Het
Myh13 A T 11: 67,364,738 K1645* probably null Het
Naip6 A G 13: 100,294,731 probably null Het
Nlrp1c-ps T C 11: 71,280,556 noncoding transcript Het
Nsmce3 A T 7: 64,872,782 L46Q probably benign Het
Olfr1084 T C 2: 86,639,168 D180G possibly damaging Het
Olfr231 T A 1: 174,117,861 M52L probably benign Het
Olfr612 A G 7: 103,539,186 V16A possibly damaging Het
Pcx T A 19: 4,619,888 V861E probably damaging Het
Pkp3 C T 7: 141,082,699 P75S probably benign Het
Plscr4 T C 9: 92,482,867 probably null Het
Pole A G 5: 110,306,387 T923A probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Rhot2 A C 17: 25,841,331 probably benign Het
Rsrp1 A G 4: 134,924,177 Y84C unknown Het
Sbf2 T C 7: 110,335,399 K1348E probably damaging Het
Sgip1 A T 4: 102,869,754 N53Y probably damaging Het
Snapc2 A G 8: 4,254,998 T127A possibly damaging Het
Snx8 A G 5: 140,355,958 probably null Het
Spag8 A G 4: 43,653,378 probably benign Het
Srebf2 T C 15: 82,192,302 F718L probably damaging Het
Szt2 C G 4: 118,375,829 probably benign Het
Traf3ip2 C T 10: 39,639,260 P345S possibly damaging Het
Tubgcp4 T A 2: 121,173,665 Y62* probably null Het
Usp29 T A 7: 6,962,915 S586T possibly damaging Het
Vasp T C 7: 19,264,425 N108S probably benign Het
Vmn1r214 A G 13: 23,034,971 M212V probably benign Het
Wipi2 G C 5: 142,659,590 A194P probably benign Het
Zbtb4 T A 11: 69,776,529 I220N probably damaging Het
Zcchc2 A T 1: 105,990,266 probably benign Het
Zfp729a T A 13: 67,621,415 K232* probably null Het
Zfp995 A T 17: 21,887,339 M1K probably null Het
Other mutations in P2ry12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:P2ry12 APN 3 59217882 missense probably damaging 1.00
IGL03075:P2ry12 APN 3 59218158 missense probably damaging 1.00
IGL02796:P2ry12 UTSW 3 59217881 missense probably damaging 1.00
R0707:P2ry12 UTSW 3 59217487 missense probably damaging 1.00
R1274:P2ry12 UTSW 3 59217220 missense possibly damaging 0.83
R1321:P2ry12 UTSW 3 59217225 missense possibly damaging 0.94
R1513:P2ry12 UTSW 3 59218077 missense probably damaging 1.00
R1781:P2ry12 UTSW 3 59217778 missense probably benign 0.04
R2108:P2ry12 UTSW 3 59217353 missense probably damaging 1.00
R3430:P2ry12 UTSW 3 59218027 missense probably damaging 1.00
R4119:P2ry12 UTSW 3 59217841 missense probably benign 0.00
R4499:P2ry12 UTSW 3 59217657 missense probably damaging 0.97
R4501:P2ry12 UTSW 3 59217657 missense probably damaging 0.97
R4823:P2ry12 UTSW 3 59217897 missense probably benign 0.00
R5643:P2ry12 UTSW 3 59218095 missense possibly damaging 0.96
R5644:P2ry12 UTSW 3 59218095 missense possibly damaging 0.96
R6246:P2ry12 UTSW 3 59217529 missense probably benign 0.00
R6261:P2ry12 UTSW 3 59217907 missense probably null 0.87
R6473:P2ry12 UTSW 3 59217511 missense probably benign 0.06
R6484:P2ry12 UTSW 3 59217333 missense probably damaging 1.00
R6654:P2ry12 UTSW 3 59218020 missense probably damaging 1.00
R7151:P2ry12 UTSW 3 59217706 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCTCCTGTTGGTGAGAATC -3'
(R):5'- CATTGCTGTACACCGTCCTG -3'

Sequencing Primer
(F):5'- CCTCCTGTTGGTGAGAATCATGTTAG -3'
(R):5'- GGCTCATCACGAACAGCTTG -3'
Posted On2015-10-08