Incidental Mutation 'R4670:Alb'
ID348349
Institutional Source Beutler Lab
Gene Symbol Alb
Ensembl Gene ENSMUSG00000029368
Gene Namealbumin
SynonymsAlb1, Alb-1
MMRRC Submission 041926-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R4670 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location90460897-90476602 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 90462806 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 82 (S82T)
Ref Sequence ENSEMBL: ENSMUSP00000031314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031314]
Predicted Effect probably benign
Transcript: ENSMUST00000031314
AA Change: S82T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000031314
Gene: ENSMUSG00000029368
AA Change: S82T

DomainStartEndE-ValueType
ALBUMIN 20 205 1.54e-84 SMART
ALBUMIN 212 397 3.43e-82 SMART
ALBUMIN 404 595 1.51e-83 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201737
Meta Mutation Damage Score 0.0576 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: This gene encodes albumin, an abundant plasma protein essential for maintaining oncotic pressure that functions as a carrier protein for various molecules such as steriods and fatty acids in blood. This gene is primarily expressed in liver where the encoded protein undergoes proteolytic processing before secretion into the plasma. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a TALEN-mediated deletion exhibit analbuminemia but appear healthy and grossly normal and breed normally. Mice heterozygotes for an ENU-induced point mutation have significantly reduced plasma albumin and calcium levels and significantly elevated alkaline phosphatase activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm5 T A 7: 119,531,760 probably null Het
Arf4 A G 14: 26,653,093 probably benign Het
Arhgap22 T C 14: 33,362,543 C260R probably damaging Het
Arhgap32 A G 9: 32,170,145 E153G probably benign Het
Arhgef18 T A 8: 3,434,897 M200K probably damaging Het
Atp1a4 T A 1: 172,235,000 N647Y probably benign Het
Atp5c1 A T 2: 10,059,617 L226Q probably damaging Het
Bcas1 T C 2: 170,384,325 K310R probably damaging Het
Cadm3 T A 1: 173,346,446 T67S probably damaging Het
Cartpt C T 13: 99,900,080 probably null Het
Cenpj A T 14: 56,553,383 V403E possibly damaging Het
Chst7 C A X: 20,060,871 R386S probably damaging Het
Cyp4f37 A T 17: 32,625,152 M77L probably benign Het
Dnah7b A T 1: 46,078,524 D50V probably damaging Het
Galnt4 A G 10: 99,109,298 D295G possibly damaging Het
Gin1 C T 1: 97,784,840 P154S probably damaging Het
Gm6471 G A 7: 142,831,623 noncoding transcript Het
Gm6818 T A 7: 38,402,557 noncoding transcript Het
Gm9271 T A 7: 39,364,310 noncoding transcript Het
Gpam A G 19: 55,096,119 probably null Het
Gpr183 T C 14: 121,954,737 D124G probably damaging Het
Ift140 C A 17: 25,098,961 probably benign Het
Itih5 A C 2: 10,190,369 I191L probably benign Het
Jcad A G 18: 4,674,175 T646A probably benign Het
Kank1 T C 19: 25,410,580 M511T probably benign Het
Krt74 A T 15: 101,758,869 noncoding transcript Het
Lrrc37a A G 11: 103,504,537 S21P probably benign Het
Lrrc8c G A 5: 105,608,374 V672I probably benign Het
Lypd4 T C 7: 24,866,726 R58G probably benign Het
Magi1 A T 6: 93,686,643 probably null Het
Mefv T A 16: 3,708,207 L745F possibly damaging Het
Myh13 A T 11: 67,364,738 K1645* probably null Het
Naip6 A G 13: 100,294,731 probably null Het
Nlrp1c-ps T C 11: 71,280,556 noncoding transcript Het
Nsmce3 A T 7: 64,872,782 L46Q probably benign Het
Olfr1084 T C 2: 86,639,168 D180G possibly damaging Het
Olfr231 T A 1: 174,117,861 M52L probably benign Het
Olfr612 A G 7: 103,539,186 V16A possibly damaging Het
P2ry12 T C 3: 59,217,904 probably null Het
Pcx T A 19: 4,619,888 V861E probably damaging Het
Pkp3 C T 7: 141,082,699 P75S probably benign Het
Plscr4 T C 9: 92,482,867 probably null Het
Pole A G 5: 110,306,387 T923A probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Rhot2 A C 17: 25,841,331 probably benign Het
Rsrp1 A G 4: 134,924,177 Y84C unknown Het
Sbf2 T C 7: 110,335,399 K1348E probably damaging Het
Sgip1 A T 4: 102,869,754 N53Y probably damaging Het
Snapc2 A G 8: 4,254,998 T127A possibly damaging Het
Snx8 A G 5: 140,355,958 probably null Het
Spag8 A G 4: 43,653,378 probably benign Het
Srebf2 T C 15: 82,192,302 F718L probably damaging Het
Szt2 C G 4: 118,375,829 probably benign Het
Traf3ip2 C T 10: 39,639,260 P345S possibly damaging Het
Tubgcp4 T A 2: 121,173,665 Y62* probably null Het
Usp29 T A 7: 6,962,915 S586T possibly damaging Het
Vasp T C 7: 19,264,425 N108S probably benign Het
Vmn1r214 A G 13: 23,034,971 M212V probably benign Het
Wipi2 G C 5: 142,659,590 A194P probably benign Het
Zbtb4 T A 11: 69,776,529 I220N probably damaging Het
Zcchc2 A T 1: 105,990,266 probably benign Het
Zfp729a T A 13: 67,621,415 K232* probably null Het
Zfp995 A T 17: 21,887,339 M1K probably null Het
Other mutations in Alb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Alb APN 5 90472073 missense probably benign 0.00
IGL01508:Alb APN 5 90470838 missense probably benign 0.19
IGL01722:Alb APN 5 90470839 critical splice donor site probably null
IGL02103:Alb APN 5 90464131 missense probably benign 0.00
IGL02379:Alb APN 5 90465879 missense probably benign 0.00
IGL02531:Alb APN 5 90467448 missense probably damaging 1.00
IGL02704:Alb APN 5 90468509 missense possibly damaging 0.82
IGL02828:Alb APN 5 90467388 missense probably benign 0.17
IGL03248:Alb APN 5 90461714 splice site probably benign
R0714:Alb UTSW 5 90462806 missense possibly damaging 0.81
R1418:Alb UTSW 5 90464202 splice site probably benign
R1708:Alb UTSW 5 90464051 missense possibly damaging 0.73
R2092:Alb UTSW 5 90463983 frame shift probably null
R4473:Alb UTSW 5 90464053 missense probably damaging 1.00
R4758:Alb UTSW 5 90468593 missense probably benign 0.00
R5583:Alb UTSW 5 90468593 missense probably benign 0.00
R6384:Alb UTSW 5 90472640 missense possibly damaging 0.67
R7268:Alb UTSW 5 90462716 missense probably benign 0.15
R7295:Alb UTSW 5 90462834 critical splice donor site probably null
R7320:Alb UTSW 5 90464987 critical splice donor site probably null
R7337:Alb UTSW 5 90474593 missense probably damaging 1.00
R7505:Alb UTSW 5 90469509 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCAGGTATACACAGGCATGA -3'
(R):5'- TACTACGTTCCCTGTAAAACTAAAGA -3'

Sequencing Primer
(F):5'- CATGATTTGCTGGTTGGGAGAGC -3'
(R):5'- GGTATGCTCTTCCAAGGCAAC -3'
Posted On2015-10-08