Incidental Mutation 'R4670:Usp29'
ID348355
Institutional Source Beutler Lab
Gene Symbol Usp29
Ensembl Gene ENSMUSG00000051527
Gene Nameubiquitin specific peptidase 29
SynonymsOcat
MMRRC Submission 041926-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4670 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location6730578-6967219 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 6962915 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 586 (S586T)
Ref Sequence ENSEMBL: ENSMUSP00000143769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054055] [ENSMUST00000197117] [ENSMUST00000198068] [ENSMUST00000200535]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054055
AA Change: S586T

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000062349
Gene: ENSMUSG00000051527
AA Change: S586T

DomainStartEndE-ValueType
Pfam:UCH_N 1 107 6.1e-37 PFAM
low complexity region 162 179 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
Pfam:UCH 288 823 6.1e-53 PFAM
Pfam:UCH_1 289 615 2.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197117
SMART Domains Protein: ENSMUSP00000143283
Gene: ENSMUSG00000051527

DomainStartEndE-ValueType
PDB:3U12|B 11 73 3e-7 PDB
low complexity region 82 95 N/A INTRINSIC
low complexity region 169 186 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000198068
AA Change: S586T

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143267
Gene: ENSMUSG00000051527
AA Change: S586T

DomainStartEndE-ValueType
PDB:3U12|B 11 123 3e-6 PDB
low complexity region 169 186 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
Pfam:UCH 295 830 7.9e-52 PFAM
Pfam:UCH_1 296 626 9.6e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000200535
AA Change: S586T

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143769
Gene: ENSMUSG00000051527
AA Change: S586T

DomainStartEndE-ValueType
Pfam:UCH_N 8 114 8.3e-34 PFAM
low complexity region 169 186 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
Pfam:UCH 295 830 2.8e-51 PFAM
Pfam:UCH_1 296 622 1.1e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204486
Meta Mutation Damage Score 0.0712 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (69/71)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm5 T A 7: 119,531,760 probably null Het
Alb T A 5: 90,462,806 S82T probably benign Het
Arf4 A G 14: 26,653,093 probably benign Het
Arhgap22 T C 14: 33,362,543 C260R probably damaging Het
Arhgap32 A G 9: 32,170,145 E153G probably benign Het
Arhgef18 T A 8: 3,434,897 M200K probably damaging Het
Atp1a4 T A 1: 172,235,000 N647Y probably benign Het
Atp5c1 A T 2: 10,059,617 L226Q probably damaging Het
Bcas1 T C 2: 170,384,325 K310R probably damaging Het
Cadm3 T A 1: 173,346,446 T67S probably damaging Het
Cartpt C T 13: 99,900,080 probably null Het
Cenpj A T 14: 56,553,383 V403E possibly damaging Het
Chst7 C A X: 20,060,871 R386S probably damaging Het
Cyp4f37 A T 17: 32,625,152 M77L probably benign Het
Dnah7b A T 1: 46,078,524 D50V probably damaging Het
Galnt4 A G 10: 99,109,298 D295G possibly damaging Het
Gin1 C T 1: 97,784,840 P154S probably damaging Het
Gm6471 G A 7: 142,831,623 noncoding transcript Het
Gm6818 T A 7: 38,402,557 noncoding transcript Het
Gm9271 T A 7: 39,364,310 noncoding transcript Het
Gpam A G 19: 55,096,119 probably null Het
Gpr183 T C 14: 121,954,737 D124G probably damaging Het
Ift140 C A 17: 25,098,961 probably benign Het
Itih5 A C 2: 10,190,369 I191L probably benign Het
Jcad A G 18: 4,674,175 T646A probably benign Het
Kank1 T C 19: 25,410,580 M511T probably benign Het
Krt74 A T 15: 101,758,869 noncoding transcript Het
Lrrc37a A G 11: 103,504,537 S21P probably benign Het
Lrrc8c G A 5: 105,608,374 V672I probably benign Het
Lypd4 T C 7: 24,866,726 R58G probably benign Het
Magi1 A T 6: 93,686,643 probably null Het
Mefv T A 16: 3,708,207 L745F possibly damaging Het
Myh13 A T 11: 67,364,738 K1645* probably null Het
Naip6 A G 13: 100,294,731 probably null Het
Nlrp1c-ps T C 11: 71,280,556 noncoding transcript Het
Nsmce3 A T 7: 64,872,782 L46Q probably benign Het
Olfr1084 T C 2: 86,639,168 D180G possibly damaging Het
Olfr231 T A 1: 174,117,861 M52L probably benign Het
Olfr612 A G 7: 103,539,186 V16A possibly damaging Het
P2ry12 T C 3: 59,217,904 probably null Het
Pcx T A 19: 4,619,888 V861E probably damaging Het
Pkp3 C T 7: 141,082,699 P75S probably benign Het
Plscr4 T C 9: 92,482,867 probably null Het
Pole A G 5: 110,306,387 T923A probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Rhot2 A C 17: 25,841,331 probably benign Het
Rsrp1 A G 4: 134,924,177 Y84C unknown Het
Sbf2 T C 7: 110,335,399 K1348E probably damaging Het
Sgip1 A T 4: 102,869,754 N53Y probably damaging Het
Snapc2 A G 8: 4,254,998 T127A possibly damaging Het
Snx8 A G 5: 140,355,958 probably null Het
Spag8 A G 4: 43,653,378 probably benign Het
Srebf2 T C 15: 82,192,302 F718L probably damaging Het
Szt2 C G 4: 118,375,829 probably benign Het
Traf3ip2 C T 10: 39,639,260 P345S possibly damaging Het
Tubgcp4 T A 2: 121,173,665 Y62* probably null Het
Vasp T C 7: 19,264,425 N108S probably benign Het
Vmn1r214 A G 13: 23,034,971 M212V probably benign Het
Wipi2 G C 5: 142,659,590 A194P probably benign Het
Zbtb4 T A 11: 69,776,529 I220N probably damaging Het
Zcchc2 A T 1: 105,990,266 probably benign Het
Zfp729a T A 13: 67,621,415 K232* probably null Het
Zfp995 A T 17: 21,887,339 M1K probably null Het
Other mutations in Usp29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Usp29 APN 7 6962282 missense probably benign 0.06
IGL01588:Usp29 APN 7 6962611 missense probably benign 0.33
IGL02032:Usp29 APN 7 6962018 missense probably benign 0.41
IGL02052:Usp29 APN 7 6962526 missense probably benign 0.06
IGL02331:Usp29 APN 7 6962156 missense probably benign 0.16
IGL02551:Usp29 APN 7 6963353 unclassified probably null
IGL02573:Usp29 APN 7 6962618 unclassified probably null
IGL02894:Usp29 APN 7 6961634 missense probably benign 0.00
R0029:Usp29 UTSW 7 6961581 missense probably damaging 0.99
R0142:Usp29 UTSW 7 6962335 missense probably benign 0.12
R0452:Usp29 UTSW 7 6963182 missense possibly damaging 0.82
R0680:Usp29 UTSW 7 6962885 missense possibly damaging 0.92
R1161:Usp29 UTSW 7 6961530 missense probably damaging 1.00
R2391:Usp29 UTSW 7 6963771 unclassified probably null
R3104:Usp29 UTSW 7 6962053 nonsense probably null
R4119:Usp29 UTSW 7 6962806 missense probably benign 0.03
R4490:Usp29 UTSW 7 6961950 missense possibly damaging 0.68
R4598:Usp29 UTSW 7 6962480 missense probably benign 0.06
R4606:Usp29 UTSW 7 6963357 unclassified probably null
R4777:Usp29 UTSW 7 6962748 missense probably benign 0.07
R4783:Usp29 UTSW 7 6961391 missense probably damaging 1.00
R4785:Usp29 UTSW 7 6961391 missense probably damaging 1.00
R4896:Usp29 UTSW 7 6962159 missense probably benign 0.29
R4915:Usp29 UTSW 7 6961505 missense probably benign
R4944:Usp29 UTSW 7 6961928 missense possibly damaging 0.92
R5004:Usp29 UTSW 7 6962159 missense probably benign 0.29
R5171:Usp29 UTSW 7 6962075 missense probably damaging 0.99
R5268:Usp29 UTSW 7 6961584 missense probably damaging 0.98
R5572:Usp29 UTSW 7 6962192 missense probably benign 0.12
R5933:Usp29 UTSW 7 6961745 missense probably benign
R6694:Usp29 UTSW 7 6962277 missense probably benign 0.03
R7389:Usp29 UTSW 7 6963458 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TGTTGCCAGTGAAGAGTGAGC -3'
(R):5'- AAGCTGTATCCGTCACCCATC -3'

Sequencing Primer
(F):5'- GCAGCCAGTTGAGATTTCTAAG -3'
(R):5'- ACCCATCATTGAGTCAGTTGCTAGTG -3'
Posted On2015-10-08