Incidental Mutation 'R4670:Kank1'
ID348395
Institutional Source Beutler Lab
Gene Symbol Kank1
Ensembl Gene ENSMUSG00000032702
Gene NameKN motif and ankyrin repeat domains 1
SynonymsD330024H06Rik, Ankrd15, A930031B09Rik
MMRRC Submission 041926-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4670 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location25236975-25434496 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25410580 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 511 (M511T)
Ref Sequence ENSEMBL: ENSMUSP00000042177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049400] [ENSMUST00000146647]
Predicted Effect probably benign
Transcript: ENSMUST00000049400
AA Change: M511T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000042177
Gene: ENSMUSG00000032702
AA Change: M511T

DomainStartEndE-ValueType
Pfam:KN_motif 30 68 3.3e-24 PFAM
low complexity region 88 105 N/A INTRINSIC
low complexity region 138 148 N/A INTRINSIC
coiled coil region 286 314 N/A INTRINSIC
low complexity region 350 358 N/A INTRINSIC
coiled coil region 362 395 N/A INTRINSIC
coiled coil region 451 494 N/A INTRINSIC
low complexity region 541 556 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Blast:ANK 963 993 7e-10 BLAST
low complexity region 1010 1030 N/A INTRINSIC
low complexity region 1074 1095 N/A INTRINSIC
ANK 1169 1199 3.71e-4 SMART
ANK 1203 1236 2.27e1 SMART
ANK 1241 1270 1.33e-5 SMART
ANK 1274 1306 5.84e-2 SMART
ANK 1308 1336 4.86e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137260
Predicted Effect probably benign
Transcript: ENSMUST00000146647
AA Change: M539T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000116660
Gene: ENSMUSG00000032702
AA Change: M539T

DomainStartEndE-ValueType
Pfam:KN_motif 58 96 2e-25 PFAM
low complexity region 116 133 N/A INTRINSIC
low complexity region 166 176 N/A INTRINSIC
coiled coil region 314 342 N/A INTRINSIC
low complexity region 378 386 N/A INTRINSIC
coiled coil region 390 423 N/A INTRINSIC
internal_repeat_1 430 479 3.72e-5 PROSPERO
low complexity region 569 584 N/A INTRINSIC
internal_repeat_1 587 636 3.72e-5 PROSPERO
low complexity region 645 657 N/A INTRINSIC
Blast:ANK 991 1021 4e-10 BLAST
low complexity region 1038 1058 N/A INTRINSIC
low complexity region 1102 1123 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Kank family of proteins, which contain multiple ankyrin repeat domains. This family member functions in cytoskeleton formation by regulating actin polymerization. This gene is a candidate tumor suppressor for renal cell carcinoma. Mutations in this gene cause cerebral palsy spastic quadriplegic type 2, a central nervous system development disorder. A t(5;9) translocation results in fusion of the platelet-derived growth factor receptor beta gene (PDGFRB) on chromosome 5 with this gene in a myeloproliferative neoplasm featuring severe thrombocythemia. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 20. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm5 T A 7: 119,531,760 probably null Het
Alb T A 5: 90,462,806 S82T probably benign Het
Arf4 A G 14: 26,653,093 probably benign Het
Arhgap22 T C 14: 33,362,543 C260R probably damaging Het
Arhgap32 A G 9: 32,170,145 E153G probably benign Het
Arhgef18 T A 8: 3,434,897 M200K probably damaging Het
Atp1a4 T A 1: 172,235,000 N647Y probably benign Het
Atp5c1 A T 2: 10,059,617 L226Q probably damaging Het
Bcas1 T C 2: 170,384,325 K310R probably damaging Het
Cadm3 T A 1: 173,346,446 T67S probably damaging Het
Cartpt C T 13: 99,900,080 probably null Het
Cenpj A T 14: 56,553,383 V403E possibly damaging Het
Chst7 C A X: 20,060,871 R386S probably damaging Het
Cyp4f37 A T 17: 32,625,152 M77L probably benign Het
Dnah7b A T 1: 46,078,524 D50V probably damaging Het
Galnt4 A G 10: 99,109,298 D295G possibly damaging Het
Gin1 C T 1: 97,784,840 P154S probably damaging Het
Gm6471 G A 7: 142,831,623 noncoding transcript Het
Gm6818 T A 7: 38,402,557 noncoding transcript Het
Gm9271 T A 7: 39,364,310 noncoding transcript Het
Gpam A G 19: 55,096,119 probably null Het
Gpr183 T C 14: 121,954,737 D124G probably damaging Het
Ift140 C A 17: 25,098,961 probably benign Het
Itih5 A C 2: 10,190,369 I191L probably benign Het
Jcad A G 18: 4,674,175 T646A probably benign Het
Krt74 A T 15: 101,758,869 noncoding transcript Het
Lrrc37a A G 11: 103,504,537 S21P probably benign Het
Lrrc8c G A 5: 105,608,374 V672I probably benign Het
Lypd4 T C 7: 24,866,726 R58G probably benign Het
Magi1 A T 6: 93,686,643 probably null Het
Mefv T A 16: 3,708,207 L745F possibly damaging Het
Myh13 A T 11: 67,364,738 K1645* probably null Het
Naip6 A G 13: 100,294,731 probably null Het
Nlrp1c-ps T C 11: 71,280,556 noncoding transcript Het
Nsmce3 A T 7: 64,872,782 L46Q probably benign Het
Olfr1084 T C 2: 86,639,168 D180G possibly damaging Het
Olfr231 T A 1: 174,117,861 M52L probably benign Het
Olfr612 A G 7: 103,539,186 V16A possibly damaging Het
P2ry12 T C 3: 59,217,904 probably null Het
Pcx T A 19: 4,619,888 V861E probably damaging Het
Pkp3 C T 7: 141,082,699 P75S probably benign Het
Plscr4 T C 9: 92,482,867 probably null Het
Pole A G 5: 110,306,387 T923A probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Rhot2 A C 17: 25,841,331 probably benign Het
Rsrp1 A G 4: 134,924,177 Y84C unknown Het
Sbf2 T C 7: 110,335,399 K1348E probably damaging Het
Sgip1 A T 4: 102,869,754 N53Y probably damaging Het
Snapc2 A G 8: 4,254,998 T127A possibly damaging Het
Snx8 A G 5: 140,355,958 probably null Het
Spag8 A G 4: 43,653,378 probably benign Het
Srebf2 T C 15: 82,192,302 F718L probably damaging Het
Szt2 C G 4: 118,375,829 probably benign Het
Traf3ip2 C T 10: 39,639,260 P345S possibly damaging Het
Tubgcp4 T A 2: 121,173,665 Y62* probably null Het
Usp29 T A 7: 6,962,915 S586T possibly damaging Het
Vasp T C 7: 19,264,425 N108S probably benign Het
Vmn1r214 A G 13: 23,034,971 M212V probably benign Het
Wipi2 G C 5: 142,659,590 A194P probably benign Het
Zbtb4 T A 11: 69,776,529 I220N probably damaging Het
Zcchc2 A T 1: 105,990,266 probably benign Het
Zfp729a T A 13: 67,621,415 K232* probably null Het
Zfp995 A T 17: 21,887,339 M1K probably null Het
Other mutations in Kank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Kank1 APN 19 25411758 missense probably benign
IGL00435:Kank1 APN 19 25430236 missense probably benign 0.41
IGL01105:Kank1 APN 19 25424316 missense possibly damaging 0.80
IGL01974:Kank1 APN 19 25410232 missense possibly damaging 0.87
IGL02031:Kank1 APN 19 25410702 missense probably benign 0.01
IGL02125:Kank1 APN 19 25410703 missense possibly damaging 0.90
IGL02152:Kank1 APN 19 25428172 missense possibly damaging 0.51
IGL02211:Kank1 APN 19 25430338 missense probably damaging 1.00
IGL02440:Kank1 APN 19 25432908 missense probably damaging 1.00
IGL02448:Kank1 APN 19 25411375 missense probably damaging 1.00
IGL02671:Kank1 APN 19 25428095 missense probably damaging 1.00
IGL03102:Kank1 APN 19 25425918 missense probably damaging 1.00
IGL03259:Kank1 APN 19 25430341 missense probably damaging 1.00
IGL02802:Kank1 UTSW 19 25411599 missense probably damaging 1.00
R0107:Kank1 UTSW 19 25430366 unclassified probably benign
R0190:Kank1 UTSW 19 25409283 missense probably benign 0.00
R0330:Kank1 UTSW 19 25424313 missense probably benign 0.00
R0368:Kank1 UTSW 19 25410603 nonsense probably null
R0399:Kank1 UTSW 19 25411242 missense probably benign 0.00
R0426:Kank1 UTSW 19 25411473 missense probably damaging 1.00
R0483:Kank1 UTSW 19 25425993 unclassified probably benign
R1394:Kank1 UTSW 19 25428164 missense probably damaging 1.00
R1495:Kank1 UTSW 19 25410349 missense probably damaging 0.98
R1681:Kank1 UTSW 19 25410304 missense possibly damaging 0.89
R1698:Kank1 UTSW 19 25411317 missense probably benign 0.11
R1830:Kank1 UTSW 19 25411032 missense probably benign 0.00
R1866:Kank1 UTSW 19 25411449 missense probably benign 0.04
R2138:Kank1 UTSW 19 25411753 missense probably benign 0.00
R2139:Kank1 UTSW 19 25411753 missense probably benign 0.00
R2420:Kank1 UTSW 19 25410457 missense probably damaging 1.00
R3153:Kank1 UTSW 19 25410688 missense possibly damaging 0.89
R4164:Kank1 UTSW 19 25411072 missense probably benign 0.10
R4685:Kank1 UTSW 19 25410034 missense possibly damaging 0.66
R4843:Kank1 UTSW 19 25431007 missense probably damaging 1.00
R4981:Kank1 UTSW 19 25411395 missense probably benign 0.19
R5189:Kank1 UTSW 19 25424181 missense probably damaging 1.00
R5280:Kank1 UTSW 19 25411305 missense probably benign 0.01
R5330:Kank1 UTSW 19 25411329 missense probably damaging 1.00
R5331:Kank1 UTSW 19 25411329 missense probably damaging 1.00
R5435:Kank1 UTSW 19 25411143 missense probably benign 0.04
R5500:Kank1 UTSW 19 25424332 missense possibly damaging 0.46
R5894:Kank1 UTSW 19 25424200 missense probably damaging 1.00
R6087:Kank1 UTSW 19 25409724 missense probably benign 0.41
R6357:Kank1 UTSW 19 25411353 missense probably benign 0.36
R6490:Kank1 UTSW 19 25410085 missense probably damaging 1.00
R6504:Kank1 UTSW 19 25428154 missense probably damaging 1.00
R6942:Kank1 UTSW 19 25424173 missense possibly damaging 0.88
R7037:Kank1 UTSW 19 25430341 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATGTTGGCATCAGCGTG -3'
(R):5'- AATTCATGGGCAGCTCGGATC -3'

Sequencing Primer
(F):5'- CATCAGCGTGACAGAAGCTATGC -3'
(R):5'- GGATCCCACGACTTGGTTC -3'
Posted On2015-10-08