Incidental Mutation 'R4671:Gm38394'
ID348401
Institutional Source Beutler Lab
Gene Symbol Gm38394
Ensembl Gene ENSMUSG00000094410
Gene Namepredicted gene, 38394
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R4671 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location133619940-133661318 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 133657040 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 853 (V853A)
Ref Sequence ENSEMBL: ENSMUSP00000140892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027736] [ENSMUST00000179598] [ENSMUST00000186476] [ENSMUST00000190574] [ENSMUST00000191896] [ENSMUST00000193504] [ENSMUST00000194668] [ENSMUST00000195067] [ENSMUST00000195424]
Predicted Effect probably benign
Transcript: ENSMUST00000027736
SMART Domains Protein: ENSMUSP00000027736
Gene: ENSMUSG00000116275

DomainStartEndE-ValueType
ZnF_C3H1 3 28 4.26e-1 SMART
ZnF_C3H1 31 56 7.62e0 SMART
ZnF_C3H1 60 86 6.83e1 SMART
low complexity region 161 176 N/A INTRINSIC
low complexity region 218 241 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 625 647 N/A INTRINSIC
low complexity region 717 730 N/A INTRINSIC
low complexity region 770 788 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179598
AA Change: V853A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136026
Gene: ENSMUSG00000094410
AA Change: V853A

DomainStartEndE-ValueType
low complexity region 57 84 N/A INTRINSIC
ZnF_BED 130 183 1.42e-8 SMART
low complexity region 203 215 N/A INTRINSIC
ZnF_BED 265 318 5.37e-9 SMART
low complexity region 840 862 N/A INTRINSIC
Pfam:Dimer_Tnp_hAT 869 950 9.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186476
AA Change: V853A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139417
Gene: ENSMUSG00000094410
AA Change: V853A

DomainStartEndE-ValueType
low complexity region 57 84 N/A INTRINSIC
ZnF_BED 130 183 1.42e-8 SMART
low complexity region 203 215 N/A INTRINSIC
ZnF_BED 265 318 5.37e-9 SMART
low complexity region 840 862 N/A INTRINSIC
Pfam:Dimer_Tnp_hAT 869 950 1.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190574
AA Change: V853A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140892
Gene: ENSMUSG00000102049
AA Change: V853A

DomainStartEndE-ValueType
low complexity region 57 84 N/A INTRINSIC
ZnF_BED 130 183 1.42e-8 SMART
low complexity region 203 215 N/A INTRINSIC
ZnF_BED 265 318 5.37e-9 SMART
low complexity region 840 862 N/A INTRINSIC
Pfam:Dimer_Tnp_hAT 869 950 1.9e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191705
Predicted Effect probably benign
Transcript: ENSMUST00000191896
SMART Domains Protein: ENSMUSP00000141255
Gene: ENSMUSG00000102976

DomainStartEndE-ValueType
ZnF_C3H1 3 28 4.26e-1 SMART
ZnF_C3H1 31 56 7.62e0 SMART
ZnF_C3H1 60 86 6.83e1 SMART
low complexity region 161 176 N/A INTRINSIC
low complexity region 218 241 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 625 647 N/A INTRINSIC
low complexity region 717 730 N/A INTRINSIC
low complexity region 770 788 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192107
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192148
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192775
Predicted Effect probably benign
Transcript: ENSMUST00000193504
SMART Domains Protein: ENSMUSP00000141895
Gene: ENSMUSG00000102976

DomainStartEndE-ValueType
ZnF_C3H1 3 28 1.8e-3 SMART
ZnF_C3H1 31 56 3.2e-2 SMART
Blast:ZnF_C3H1 60 84 2e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194668
SMART Domains Protein: ENSMUSP00000141727
Gene: ENSMUSG00000102976

DomainStartEndE-ValueType
ZnF_C3H1 3 28 1.8e-3 SMART
ZnF_C3H1 31 56 3.2e-2 SMART
ZnF_C3H1 60 86 2.9e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195067
Predicted Effect probably benign
Transcript: ENSMUST00000195424
SMART Domains Protein: ENSMUSP00000142066
Gene: ENSMUSG00000102976

DomainStartEndE-ValueType
ZnF_C3H1 3 28 1.8e-3 SMART
ZnF_C3H1 31 56 3.2e-2 SMART
ZnF_C3H1 60 86 2.9e-1 SMART
low complexity region 161 176 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,718,859 I637V probably benign Het
Abcc2 T C 19: 43,800,718 S271P probably benign Het
Acod1 T G 14: 103,047,072 M2R probably benign Het
Adamts20 T C 15: 94,403,325 E106G possibly damaging Het
Adgra3 G A 5: 49,979,368 T661M probably damaging Het
Akap13 T A 7: 75,579,564 C161* probably null Het
Akr1c12 A C 13: 4,273,817 S162A possibly damaging Het
Anks1 C A 17: 28,051,578 H805N probably benign Het
Arhgap22 T C 14: 33,362,543 C260R probably damaging Het
Banf1 T C 19: 5,365,844 R33G probably benign Het
Bcas1 T C 2: 170,384,325 K310R probably damaging Het
Cacna1c G T 6: 118,652,058 H1240N probably damaging Het
Cartpt C T 13: 99,900,080 probably null Het
Ccdc127 T A 13: 74,357,045 Y237* probably null Het
Ccnb1ip1 A T 14: 50,792,277 Y109* probably null Het
Cenpj A T 14: 56,553,383 V403E possibly damaging Het
Cps1 A G 1: 67,196,560 Y951C probably damaging Het
Dcakd T C 11: 102,999,808 E51G possibly damaging Het
Dennd4a A T 9: 64,894,407 N944I probably benign Het
Dus3l C T 17: 56,768,566 R430C probably benign Het
Dync2h1 A G 9: 7,169,640 L279P possibly damaging Het
Dzip3 G A 16: 48,979,590 Q112* probably null Het
Eif1ad T A 19: 5,368,191 M1K probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam46c C A 3: 100,473,199 L80F probably benign Het
Fancg T C 4: 43,005,272 E366G probably benign Het
Gin1 C T 1: 97,784,840 P154S probably damaging Het
Gm11938 A T 11: 99,603,006 C88S possibly damaging Het
Gpr183 T C 14: 121,954,737 D124G probably damaging Het
Gucy2g T A 19: 55,238,068 I139F probably damaging Het
Iqub A T 6: 24,479,184 M453K probably benign Het
Jcad A G 18: 4,674,175 T646A probably benign Het
Kif23 A T 9: 61,945,359 D24E probably benign Het
Kmt2c T C 5: 25,366,177 N845S probably damaging Het
Lhx5 G A 5: 120,439,967 S284N probably benign Het
Lipf T G 19: 33,976,676 V389G possibly damaging Het
Lrrc7 C T 3: 158,202,495 probably null Het
Magi1 A G 6: 93,680,787 probably null Het
Mast2 A G 4: 116,308,650 S1287P probably damaging Het
Mepce C T 5: 137,786,643 probably benign Het
Mkrn1 A G 6: 39,405,757 V173A probably damaging Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Naip6 A G 13: 100,294,731 probably null Het
Nsmce3 A T 7: 64,872,782 L46Q probably benign Het
Olfr1294 A T 2: 111,537,935 M118K probably damaging Het
Olfr354 G A 2: 36,907,393 C149Y probably benign Het
Olfr531 T G 7: 140,400,305 Y247S probably damaging Het
Olfr681 T C 7: 105,122,306 L283P probably damaging Het
Olfr78 A G 7: 102,742,601 V134A probably damaging Het
Parp14 A G 16: 35,858,321 F426L probably benign Het
Pcf11 A T 7: 92,657,529 S1144T possibly damaging Het
Prpf3 T A 3: 95,851,664 T59S possibly damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptk7 A G 17: 46,574,466 V678A probably benign Het
Rb1 A G 14: 73,273,676 L331S probably damaging Het
Sell A G 1: 164,065,473 Y86C probably damaging Het
Serpina1e G A 12: 103,948,082 R328W probably damaging Het
Sertad3 T G 7: 27,476,666 L175R possibly damaging Het
Stard9 G T 2: 120,698,640 G1793W probably damaging Het
Stra6 T C 9: 58,149,234 I383T probably benign Het
Tcf7l1 A G 6: 72,649,178 L154P probably damaging Het
Tonsl A T 15: 76,623,410 D55E probably benign Het
Ttc21b A G 2: 66,226,913 S572P possibly damaging Het
Ttc7 T A 17: 87,346,620 L575Q probably damaging Het
Ubl4b C T 3: 107,554,878 S22N probably damaging Het
Ubr4 T C 4: 139,436,191 V2634A possibly damaging Het
Zfp46 A C 4: 136,290,173 D106A probably damaging Het
Zfp951 A C 5: 104,814,701 I333S probably benign Het
Other mutations in Gm38394
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0385:Gm38394 UTSW 1 133656784 missense probably damaging 0.99
R0417:Gm38394 UTSW 1 133658538 missense probably benign
R0526:Gm38394 UTSW 1 133658734 missense probably damaging 0.99
R0576:Gm38394 UTSW 1 133657838 missense probably benign 0.37
R1164:Gm38394 UTSW 1 133659203 missense probably damaging 1.00
R1187:Gm38394 UTSW 1 133659203 missense probably damaging 1.00
R1415:Gm38394 UTSW 1 133657818 missense possibly damaging 0.80
R1997:Gm38394 UTSW 1 133656713 missense probably damaging 1.00
R2186:Gm38394 UTSW 1 133658079 missense probably damaging 1.00
R2875:Gm38394 UTSW 1 133656860 missense probably damaging 1.00
R2876:Gm38394 UTSW 1 133656860 missense probably damaging 1.00
R2975:Gm38394 UTSW 1 133658237 missense probably damaging 0.99
R4573:Gm38394 UTSW 1 133659389 missense probably benign 0.00
R4631:Gm38394 UTSW 1 133658744 missense probably damaging 1.00
R4976:Gm38394 UTSW 1 133658094 missense probably benign 0.27
R5048:Gm38394 UTSW 1 133658724 missense probably damaging 0.99
R5318:Gm38394 UTSW 1 133658115 missense possibly damaging 0.86
R5400:Gm38394 UTSW 1 133658141 missense probably damaging 1.00
R5427:Gm38394 UTSW 1 133657595 missense possibly damaging 0.83
R6530:Gm38394 UTSW 1 133659201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGCCCATTTTAAGTAGGACAAG -3'
(R):5'- AGATCCTTGCAGAAGAGGTTTG -3'

Sequencing Primer
(F):5'- TTGCCAACTACACATGGGG -3'
(R):5'- GTAATTATATGGAATCTTCGCCAGGG -3'
Posted On2015-10-08