Incidental Mutation 'R4671:Olfr1294'
ID348405
Institutional Source Beutler Lab
Gene Symbol Olfr1294
Ensembl Gene ENSMUSG00000109547
Gene Nameolfactory receptor 1294
SynonymsGA_x6K02T2Q125-72589785-72588847, MOR248-7
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R4671 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location111536530-111540291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 111537935 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 118 (M118K)
Ref Sequence ENSEMBL: ENSMUSP00000146438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000208334] [ENSMUST00000208675] [ENSMUST00000215245]
Predicted Effect probably damaging
Transcript: ENSMUST00000099614
AA Change: M118K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097209
Gene: ENSMUSG00000094000
AA Change: M118K

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 1.7e-51 PFAM
Pfam:7tm_1 41 287 2e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000208334
AA Change: M118K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000208675
AA Change: M118K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215245
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,718,859 I637V probably benign Het
Abcc2 T C 19: 43,800,718 S271P probably benign Het
Acod1 T G 14: 103,047,072 M2R probably benign Het
Adamts20 T C 15: 94,403,325 E106G possibly damaging Het
Adgra3 G A 5: 49,979,368 T661M probably damaging Het
Akap13 T A 7: 75,579,564 C161* probably null Het
Akr1c12 A C 13: 4,273,817 S162A possibly damaging Het
Anks1 C A 17: 28,051,578 H805N probably benign Het
Arhgap22 T C 14: 33,362,543 C260R probably damaging Het
Banf1 T C 19: 5,365,844 R33G probably benign Het
Bcas1 T C 2: 170,384,325 K310R probably damaging Het
Cacna1c G T 6: 118,652,058 H1240N probably damaging Het
Cartpt C T 13: 99,900,080 probably null Het
Ccdc127 T A 13: 74,357,045 Y237* probably null Het
Ccnb1ip1 A T 14: 50,792,277 Y109* probably null Het
Cenpj A T 14: 56,553,383 V403E possibly damaging Het
Cps1 A G 1: 67,196,560 Y951C probably damaging Het
Dcakd T C 11: 102,999,808 E51G possibly damaging Het
Dennd4a A T 9: 64,894,407 N944I probably benign Het
Dus3l C T 17: 56,768,566 R430C probably benign Het
Dync2h1 A G 9: 7,169,640 L279P possibly damaging Het
Dzip3 G A 16: 48,979,590 Q112* probably null Het
Eif1ad T A 19: 5,368,191 M1K probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam46c C A 3: 100,473,199 L80F probably benign Het
Fancg T C 4: 43,005,272 E366G probably benign Het
Gin1 C T 1: 97,784,840 P154S probably damaging Het
Gm11938 A T 11: 99,603,006 C88S possibly damaging Het
Gm38394 A G 1: 133,657,040 V853A probably benign Het
Gpr183 T C 14: 121,954,737 D124G probably damaging Het
Gucy2g T A 19: 55,238,068 I139F probably damaging Het
Iqub A T 6: 24,479,184 M453K probably benign Het
Jcad A G 18: 4,674,175 T646A probably benign Het
Kif23 A T 9: 61,945,359 D24E probably benign Het
Kmt2c T C 5: 25,366,177 N845S probably damaging Het
Lhx5 G A 5: 120,439,967 S284N probably benign Het
Lipf T G 19: 33,976,676 V389G possibly damaging Het
Lrrc7 C T 3: 158,202,495 probably null Het
Magi1 A G 6: 93,680,787 probably null Het
Mast2 A G 4: 116,308,650 S1287P probably damaging Het
Mepce C T 5: 137,786,643 probably benign Het
Mkrn1 A G 6: 39,405,757 V173A probably damaging Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Naip6 A G 13: 100,294,731 probably null Het
Nsmce3 A T 7: 64,872,782 L46Q probably benign Het
Olfr354 G A 2: 36,907,393 C149Y probably benign Het
Olfr531 T G 7: 140,400,305 Y247S probably damaging Het
Olfr681 T C 7: 105,122,306 L283P probably damaging Het
Olfr78 A G 7: 102,742,601 V134A probably damaging Het
Parp14 A G 16: 35,858,321 F426L probably benign Het
Pcf11 A T 7: 92,657,529 S1144T possibly damaging Het
Prpf3 T A 3: 95,851,664 T59S possibly damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptk7 A G 17: 46,574,466 V678A probably benign Het
Rb1 A G 14: 73,273,676 L331S probably damaging Het
Sell A G 1: 164,065,473 Y86C probably damaging Het
Serpina1e G A 12: 103,948,082 R328W probably damaging Het
Sertad3 T G 7: 27,476,666 L175R possibly damaging Het
Stard9 G T 2: 120,698,640 G1793W probably damaging Het
Stra6 T C 9: 58,149,234 I383T probably benign Het
Tcf7l1 A G 6: 72,649,178 L154P probably damaging Het
Tonsl A T 15: 76,623,410 D55E probably benign Het
Ttc21b A G 2: 66,226,913 S572P possibly damaging Het
Ttc7 T A 17: 87,346,620 L575Q probably damaging Het
Ubl4b C T 3: 107,554,878 S22N probably damaging Het
Ubr4 T C 4: 139,436,191 V2634A possibly damaging Het
Zfp46 A C 4: 136,290,173 D106A probably damaging Het
Zfp951 A C 5: 104,814,701 I333S probably benign Het
Other mutations in Olfr1294
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Olfr1294 APN 2 111538014 missense probably damaging 1.00
IGL02304:Olfr1294 APN 2 111537401 missense probably benign 0.06
IGL02555:Olfr1294 APN 2 111537917 missense probably damaging 0.98
R0422:Olfr1294 UTSW 2 111537983 missense probably damaging 0.97
R0647:Olfr1294 UTSW 2 111537359 missense probably benign 0.00
R0656:Olfr1294 UTSW 2 111537627 missense probably damaging 1.00
R1543:Olfr1294 UTSW 2 111537797 missense probably benign 0.00
R1909:Olfr1294 UTSW 2 111538014 missense probably damaging 1.00
R3735:Olfr1294 UTSW 2 111537896 missense probably damaging 1.00
R4703:Olfr1294 UTSW 2 111537768 missense probably benign 0.03
R4809:Olfr1294 UTSW 2 111537611 missense probably benign 0.15
R4822:Olfr1294 UTSW 2 111537452 missense probably damaging 0.98
R4837:Olfr1294 UTSW 2 111537974 missense probably damaging 0.98
R4880:Olfr1294 UTSW 2 111537353 nonsense probably null
R5203:Olfr1294 UTSW 2 111537636 missense probably damaging 1.00
R5871:Olfr1294 UTSW 2 111537639 missense probably damaging 1.00
R5902:Olfr1294 UTSW 2 111537394 missense probably benign 0.00
R6501:Olfr1294 UTSW 2 111537779 missense probably damaging 1.00
R7354:Olfr1294 UTSW 2 111537564 missense possibly damaging 0.94
Z1088:Olfr1294 UTSW 2 111537814 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TACCAGTGGCATGTCACAG -3'
(R):5'- ACTGACACCCATCTGCATTC -3'

Sequencing Primer
(F):5'- GAAGAAACTGTCTATTTCATTGGGAC -3'
(R):5'- CCCATGTACTTCTTGCTGGC -3'
Posted On2015-10-08