Incidental Mutation 'R4671:Prpf3'
ID348408
Institutional Source Beutler Lab
Gene Symbol Prpf3
Ensembl Gene ENSMUSG00000015748
Gene Namepre-mRNA processing factor 3
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4671 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location95830124-95855885 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 95851664 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 59 (T59S)
Ref Sequence ENSEMBL: ENSMUSP00000124302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015892] [ENSMUST00000160109] [ENSMUST00000161476]
Predicted Effect possibly damaging
Transcript: ENSMUST00000015892
AA Change: T59S

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000015892
Gene: ENSMUSG00000015748
AA Change: T59S

DomainStartEndE-ValueType
PWI 3 76 5.99e-29 SMART
low complexity region 112 135 N/A INTRINSIC
Pfam:PRP3 308 521 1.3e-82 PFAM
low complexity region 526 534 N/A INTRINSIC
Pfam:DUF1115 544 673 1.1e-51 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000160109
AA Change: T59S

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124302
Gene: ENSMUSG00000015748
AA Change: T59S

DomainStartEndE-ValueType
PWI 3 76 5.99e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160155
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161073
Predicted Effect possibly damaging
Transcript: ENSMUST00000161476
AA Change: T59S

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124950
Gene: ENSMUSG00000015748
AA Change: T59S

DomainStartEndE-ValueType
PWI 3 76 5.99e-29 SMART
low complexity region 112 135 N/A INTRINSIC
Pfam:PRP3 307 522 5.4e-74 PFAM
low complexity region 526 534 N/A INTRINSIC
Pfam:DUF1115 543 674 3.2e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180383
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The removal of introns from nuclear pre-mRNAs occurs on complexes called spliceosomes, which are made up of 4 small nuclear ribonucleoprotein (snRNP) particles and an undefined number of transiently associated splicing factors. This gene product is one of several proteins that associate with U4 and U6 snRNPs. Mutations in this gene are associated with retinitis pigmentosa-18. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,718,859 I637V probably benign Het
Abcc2 T C 19: 43,800,718 S271P probably benign Het
Acod1 T G 14: 103,047,072 M2R probably benign Het
Adamts20 T C 15: 94,403,325 E106G possibly damaging Het
Adgra3 G A 5: 49,979,368 T661M probably damaging Het
Akap13 T A 7: 75,579,564 C161* probably null Het
Akr1c12 A C 13: 4,273,817 S162A possibly damaging Het
Anks1 C A 17: 28,051,578 H805N probably benign Het
Arhgap22 T C 14: 33,362,543 C260R probably damaging Het
Banf1 T C 19: 5,365,844 R33G probably benign Het
Bcas1 T C 2: 170,384,325 K310R probably damaging Het
Cacna1c G T 6: 118,652,058 H1240N probably damaging Het
Cartpt C T 13: 99,900,080 probably null Het
Ccdc127 T A 13: 74,357,045 Y237* probably null Het
Ccnb1ip1 A T 14: 50,792,277 Y109* probably null Het
Cenpj A T 14: 56,553,383 V403E possibly damaging Het
Cps1 A G 1: 67,196,560 Y951C probably damaging Het
Dcakd T C 11: 102,999,808 E51G possibly damaging Het
Dennd4a A T 9: 64,894,407 N944I probably benign Het
Dus3l C T 17: 56,768,566 R430C probably benign Het
Dync2h1 A G 9: 7,169,640 L279P possibly damaging Het
Dzip3 G A 16: 48,979,590 Q112* probably null Het
Eif1ad T A 19: 5,368,191 M1K probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam46c C A 3: 100,473,199 L80F probably benign Het
Fancg T C 4: 43,005,272 E366G probably benign Het
Gin1 C T 1: 97,784,840 P154S probably damaging Het
Gm11938 A T 11: 99,603,006 C88S possibly damaging Het
Gm38394 A G 1: 133,657,040 V853A probably benign Het
Gpr183 T C 14: 121,954,737 D124G probably damaging Het
Gucy2g T A 19: 55,238,068 I139F probably damaging Het
Iqub A T 6: 24,479,184 M453K probably benign Het
Jcad A G 18: 4,674,175 T646A probably benign Het
Kif23 A T 9: 61,945,359 D24E probably benign Het
Kmt2c T C 5: 25,366,177 N845S probably damaging Het
Lhx5 G A 5: 120,439,967 S284N probably benign Het
Lipf T G 19: 33,976,676 V389G possibly damaging Het
Lrrc7 C T 3: 158,202,495 probably null Het
Magi1 A G 6: 93,680,787 probably null Het
Mast2 A G 4: 116,308,650 S1287P probably damaging Het
Mepce C T 5: 137,786,643 probably benign Het
Mkrn1 A G 6: 39,405,757 V173A probably damaging Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Naip6 A G 13: 100,294,731 probably null Het
Nsmce3 A T 7: 64,872,782 L46Q probably benign Het
Olfr1294 A T 2: 111,537,935 M118K probably damaging Het
Olfr354 G A 2: 36,907,393 C149Y probably benign Het
Olfr531 T G 7: 140,400,305 Y247S probably damaging Het
Olfr681 T C 7: 105,122,306 L283P probably damaging Het
Olfr78 A G 7: 102,742,601 V134A probably damaging Het
Parp14 A G 16: 35,858,321 F426L probably benign Het
Pcf11 A T 7: 92,657,529 S1144T possibly damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptk7 A G 17: 46,574,466 V678A probably benign Het
Rb1 A G 14: 73,273,676 L331S probably damaging Het
Sell A G 1: 164,065,473 Y86C probably damaging Het
Serpina1e G A 12: 103,948,082 R328W probably damaging Het
Sertad3 T G 7: 27,476,666 L175R possibly damaging Het
Stard9 G T 2: 120,698,640 G1793W probably damaging Het
Stra6 T C 9: 58,149,234 I383T probably benign Het
Tcf7l1 A G 6: 72,649,178 L154P probably damaging Het
Tonsl A T 15: 76,623,410 D55E probably benign Het
Ttc21b A G 2: 66,226,913 S572P possibly damaging Het
Ttc7 T A 17: 87,346,620 L575Q probably damaging Het
Ubl4b C T 3: 107,554,878 S22N probably damaging Het
Ubr4 T C 4: 139,436,191 V2634A possibly damaging Het
Zfp46 A C 4: 136,290,173 D106A probably damaging Het
Zfp951 A C 5: 104,814,701 I333S probably benign Het
Other mutations in Prpf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02175:Prpf3 APN 3 95834107 missense probably damaging 0.99
IGL02825:Prpf3 APN 3 95853480 missense probably damaging 1.00
R0940:Prpf3 UTSW 3 95844223 missense probably damaging 1.00
R1542:Prpf3 UTSW 3 95836470 missense probably benign 0.08
R1545:Prpf3 UTSW 3 95847803 missense probably damaging 0.99
R2063:Prpf3 UTSW 3 95844239 missense probably benign
R2084:Prpf3 UTSW 3 95848989 missense probably benign 0.44
R2160:Prpf3 UTSW 3 95845230 missense probably benign 0.19
R3110:Prpf3 UTSW 3 95849800 intron probably benign
R3112:Prpf3 UTSW 3 95849800 intron probably benign
R4636:Prpf3 UTSW 3 95834170 missense probably damaging 0.99
R4689:Prpf3 UTSW 3 95836489 nonsense probably null
R4702:Prpf3 UTSW 3 95834092 missense probably damaging 0.97
R5080:Prpf3 UTSW 3 95833797 missense probably benign 0.45
R5177:Prpf3 UTSW 3 95849724 intron probably benign
R5290:Prpf3 UTSW 3 95853545 missense probably benign 0.39
R5397:Prpf3 UTSW 3 95853579 missense probably benign 0.09
R6329:Prpf3 UTSW 3 95832578 missense probably damaging 1.00
R7133:Prpf3 UTSW 3 95833740 splice site probably null
X0063:Prpf3 UTSW 3 95840715 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTAAGCTCAGCACGTTTCTTATC -3'
(R):5'- ATCAGAAACTGGGAATTCTGCAAAG -3'

Sequencing Primer
(F):5'- TATCGTTCCAAACACTGCTGAG -3'
(R):5'- AAGGTCCAGTGTTCAAGTCC -3'
Posted On2015-10-08