Incidental Mutation 'R4671:Fam46c'
ID348409
Institutional Source Beutler Lab
Gene Symbol Fam46c
Ensembl Gene ENSMUSG00000044468
Gene Namefamily with sequence similarity 46, member C
Synonyms4930431B09Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4671 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location100451628-100489324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 100473199 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 80 (L80F)
Ref Sequence ENSEMBL: ENSMUSP00000056872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061455]
Predicted Effect probably benign
Transcript: ENSMUST00000061455
AA Change: L80F

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000056872
Gene: ENSMUSG00000044468
AA Change: L80F

DomainStartEndE-ValueType
DUF1693 17 336 3.33e-241 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128107
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139833
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypochromic microcytic anemia and decreased B cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,718,859 I637V probably benign Het
Abcc2 T C 19: 43,800,718 S271P probably benign Het
Acod1 T G 14: 103,047,072 M2R probably benign Het
Adamts20 T C 15: 94,403,325 E106G possibly damaging Het
Adgra3 G A 5: 49,979,368 T661M probably damaging Het
Akap13 T A 7: 75,579,564 C161* probably null Het
Akr1c12 A C 13: 4,273,817 S162A possibly damaging Het
Anks1 C A 17: 28,051,578 H805N probably benign Het
Arhgap22 T C 14: 33,362,543 C260R probably damaging Het
Banf1 T C 19: 5,365,844 R33G probably benign Het
Bcas1 T C 2: 170,384,325 K310R probably damaging Het
Cacna1c G T 6: 118,652,058 H1240N probably damaging Het
Cartpt C T 13: 99,900,080 probably null Het
Ccdc127 T A 13: 74,357,045 Y237* probably null Het
Ccnb1ip1 A T 14: 50,792,277 Y109* probably null Het
Cenpj A T 14: 56,553,383 V403E possibly damaging Het
Cps1 A G 1: 67,196,560 Y951C probably damaging Het
Dcakd T C 11: 102,999,808 E51G possibly damaging Het
Dennd4a A T 9: 64,894,407 N944I probably benign Het
Dus3l C T 17: 56,768,566 R430C probably benign Het
Dync2h1 A G 9: 7,169,640 L279P possibly damaging Het
Dzip3 G A 16: 48,979,590 Q112* probably null Het
Eif1ad T A 19: 5,368,191 M1K probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fancg T C 4: 43,005,272 E366G probably benign Het
Gin1 C T 1: 97,784,840 P154S probably damaging Het
Gm11938 A T 11: 99,603,006 C88S possibly damaging Het
Gm38394 A G 1: 133,657,040 V853A probably benign Het
Gpr183 T C 14: 121,954,737 D124G probably damaging Het
Gucy2g T A 19: 55,238,068 I139F probably damaging Het
Iqub A T 6: 24,479,184 M453K probably benign Het
Jcad A G 18: 4,674,175 T646A probably benign Het
Kif23 A T 9: 61,945,359 D24E probably benign Het
Kmt2c T C 5: 25,366,177 N845S probably damaging Het
Lhx5 G A 5: 120,439,967 S284N probably benign Het
Lipf T G 19: 33,976,676 V389G possibly damaging Het
Lrrc7 C T 3: 158,202,495 probably null Het
Magi1 A G 6: 93,680,787 probably null Het
Mast2 A G 4: 116,308,650 S1287P probably damaging Het
Mepce C T 5: 137,786,643 probably benign Het
Mkrn1 A G 6: 39,405,757 V173A probably damaging Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Naip6 A G 13: 100,294,731 probably null Het
Nsmce3 A T 7: 64,872,782 L46Q probably benign Het
Olfr1294 A T 2: 111,537,935 M118K probably damaging Het
Olfr354 G A 2: 36,907,393 C149Y probably benign Het
Olfr531 T G 7: 140,400,305 Y247S probably damaging Het
Olfr681 T C 7: 105,122,306 L283P probably damaging Het
Olfr78 A G 7: 102,742,601 V134A probably damaging Het
Parp14 A G 16: 35,858,321 F426L probably benign Het
Pcf11 A T 7: 92,657,529 S1144T possibly damaging Het
Prpf3 T A 3: 95,851,664 T59S possibly damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptk7 A G 17: 46,574,466 V678A probably benign Het
Rb1 A G 14: 73,273,676 L331S probably damaging Het
Sell A G 1: 164,065,473 Y86C probably damaging Het
Serpina1e G A 12: 103,948,082 R328W probably damaging Het
Sertad3 T G 7: 27,476,666 L175R possibly damaging Het
Stard9 G T 2: 120,698,640 G1793W probably damaging Het
Stra6 T C 9: 58,149,234 I383T probably benign Het
Tcf7l1 A G 6: 72,649,178 L154P probably damaging Het
Tonsl A T 15: 76,623,410 D55E probably benign Het
Ttc21b A G 2: 66,226,913 S572P possibly damaging Het
Ttc7 T A 17: 87,346,620 L575Q probably damaging Het
Ubl4b C T 3: 107,554,878 S22N probably damaging Het
Ubr4 T C 4: 139,436,191 V2634A possibly damaging Het
Zfp46 A C 4: 136,290,173 D106A probably damaging Het
Zfp951 A C 5: 104,814,701 I333S probably benign Het
Other mutations in Fam46c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Fam46c APN 3 100473356 missense probably damaging 0.96
IGL01314:Fam46c APN 3 100473174 missense probably benign 0.18
IGL01409:Fam46c APN 3 100473169 missense probably damaging 1.00
IGL01817:Fam46c APN 3 100472855 missense probably damaging 1.00
IGL01863:Fam46c APN 3 100472664 missense probably benign 0.05
IGL01992:Fam46c APN 3 100472630 missense probably damaging 1.00
IGL02436:Fam46c APN 3 100472507 missense probably benign 0.43
R0111:Fam46c UTSW 3 100472786 missense probably damaging 1.00
R0529:Fam46c UTSW 3 100472370 missense probably benign 0.36
R1196:Fam46c UTSW 3 100473000 missense possibly damaging 0.73
R1242:Fam46c UTSW 3 100472876 missense probably damaging 1.00
R5252:Fam46c UTSW 3 100472708 missense probably damaging 1.00
R6730:Fam46c UTSW 3 100472957 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GTGTCTGTGCAAACCTTCACC -3'
(R):5'- TGCTCAACTGGGATCAGGTTAG -3'

Sequencing Primer
(F):5'- ACCAGCTTCTGCACGTACG -3'
(R):5'- ATCAGGTTAGCCGGCTGCAC -3'
Posted On2015-10-08