Incidental Mutation 'R4671:Lhx5'
ID348425
Institutional Source Beutler Lab
Gene Symbol Lhx5
Ensembl Gene ENSMUSG00000029595
Gene NameLIM homeobox protein 5
SynonymsLim2
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.584) question?
Stock #R4671 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location120431699-120441223 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 120439967 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 284 (S284N)
Ref Sequence ENSEMBL: ENSMUSP00000031591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031591]
Predicted Effect probably benign
Transcript: ENSMUST00000031591
AA Change: S284N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000031591
Gene: ENSMUSG00000029595
AA Change: S284N

DomainStartEndE-ValueType
LIM 4 55 1.7e-17 SMART
LIM 63 118 3e-18 SMART
low complexity region 120 135 N/A INTRINSIC
low complexity region 140 153 N/A INTRINSIC
HOX 180 242 1.33e-22 SMART
low complexity region 276 287 N/A INTRINSIC
low complexity region 300 311 N/A INTRINSIC
low complexity region 322 336 N/A INTRINSIC
low complexity region 370 384 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to a large protein family, members of which carry the LIM domain, a unique cysteine-rich zinc-binding domain. The encoded protein may function as a transcriptional regulator and be involved in the control of differentiation and development of the forebrain. In mice, this protein is essential for the regulation of precursor cell proliferation and the control of neuronal differentiation and migration during hippocampal development. This protein is involved in learning and motor functions in adult mice. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most mice homozygous for a null mutation display defective hippocampal development and die within a few days after birth. Postmitotic hippocampal cells are unable to differentiate properly and migrate to correct positions, resulting in structural anomalies of the Ammon's horn and the dentate gyrus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,718,859 I637V probably benign Het
Abcc2 T C 19: 43,800,718 S271P probably benign Het
Acod1 T G 14: 103,047,072 M2R probably benign Het
Adamts20 T C 15: 94,403,325 E106G possibly damaging Het
Adgra3 G A 5: 49,979,368 T661M probably damaging Het
Akap13 T A 7: 75,579,564 C161* probably null Het
Akr1c12 A C 13: 4,273,817 S162A possibly damaging Het
Anks1 C A 17: 28,051,578 H805N probably benign Het
Arhgap22 T C 14: 33,362,543 C260R probably damaging Het
Banf1 T C 19: 5,365,844 R33G probably benign Het
Bcas1 T C 2: 170,384,325 K310R probably damaging Het
Cacna1c G T 6: 118,652,058 H1240N probably damaging Het
Cartpt C T 13: 99,900,080 probably null Het
Ccdc127 T A 13: 74,357,045 Y237* probably null Het
Ccnb1ip1 A T 14: 50,792,277 Y109* probably null Het
Cenpj A T 14: 56,553,383 V403E possibly damaging Het
Cps1 A G 1: 67,196,560 Y951C probably damaging Het
Dcakd T C 11: 102,999,808 E51G possibly damaging Het
Dennd4a A T 9: 64,894,407 N944I probably benign Het
Dus3l C T 17: 56,768,566 R430C probably benign Het
Dync2h1 A G 9: 7,169,640 L279P possibly damaging Het
Dzip3 G A 16: 48,979,590 Q112* probably null Het
Eif1ad T A 19: 5,368,191 M1K probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam46c C A 3: 100,473,199 L80F probably benign Het
Fancg T C 4: 43,005,272 E366G probably benign Het
Gin1 C T 1: 97,784,840 P154S probably damaging Het
Gm11938 A T 11: 99,603,006 C88S possibly damaging Het
Gm38394 A G 1: 133,657,040 V853A probably benign Het
Gpr183 T C 14: 121,954,737 D124G probably damaging Het
Gucy2g T A 19: 55,238,068 I139F probably damaging Het
Iqub A T 6: 24,479,184 M453K probably benign Het
Jcad A G 18: 4,674,175 T646A probably benign Het
Kif23 A T 9: 61,945,359 D24E probably benign Het
Kmt2c T C 5: 25,366,177 N845S probably damaging Het
Lipf T G 19: 33,976,676 V389G possibly damaging Het
Lrrc7 C T 3: 158,202,495 probably null Het
Magi1 A G 6: 93,680,787 probably null Het
Mast2 A G 4: 116,308,650 S1287P probably damaging Het
Mepce C T 5: 137,786,643 probably benign Het
Mkrn1 A G 6: 39,405,757 V173A probably damaging Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Naip6 A G 13: 100,294,731 probably null Het
Nsmce3 A T 7: 64,872,782 L46Q probably benign Het
Olfr1294 A T 2: 111,537,935 M118K probably damaging Het
Olfr354 G A 2: 36,907,393 C149Y probably benign Het
Olfr531 T G 7: 140,400,305 Y247S probably damaging Het
Olfr681 T C 7: 105,122,306 L283P probably damaging Het
Olfr78 A G 7: 102,742,601 V134A probably damaging Het
Parp14 A G 16: 35,858,321 F426L probably benign Het
Pcf11 A T 7: 92,657,529 S1144T possibly damaging Het
Prpf3 T A 3: 95,851,664 T59S possibly damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptk7 A G 17: 46,574,466 V678A probably benign Het
Rb1 A G 14: 73,273,676 L331S probably damaging Het
Sell A G 1: 164,065,473 Y86C probably damaging Het
Serpina1e G A 12: 103,948,082 R328W probably damaging Het
Sertad3 T G 7: 27,476,666 L175R possibly damaging Het
Stard9 G T 2: 120,698,640 G1793W probably damaging Het
Stra6 T C 9: 58,149,234 I383T probably benign Het
Tcf7l1 A G 6: 72,649,178 L154P probably damaging Het
Tonsl A T 15: 76,623,410 D55E probably benign Het
Ttc21b A G 2: 66,226,913 S572P possibly damaging Het
Ttc7 T A 17: 87,346,620 L575Q probably damaging Het
Ubl4b C T 3: 107,554,878 S22N probably damaging Het
Ubr4 T C 4: 139,436,191 V2634A possibly damaging Het
Zfp46 A C 4: 136,290,173 D106A probably damaging Het
Zfp951 A C 5: 104,814,701 I333S probably benign Het
Other mutations in Lhx5
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1793:Lhx5 UTSW 5 120434660 missense probably damaging 1.00
R2958:Lhx5 UTSW 5 120435477 missense probably benign 0.09
R3019:Lhx5 UTSW 5 120440005 missense probably benign 0.02
R4504:Lhx5 UTSW 5 120440008 missense possibly damaging 0.92
R4505:Lhx5 UTSW 5 120440008 missense possibly damaging 0.92
R4507:Lhx5 UTSW 5 120440008 missense possibly damaging 0.92
R4508:Lhx5 UTSW 5 120435434 missense probably damaging 0.99
R4769:Lhx5 UTSW 5 120436438 missense probably benign 0.22
R5547:Lhx5 UTSW 5 120434610 missense probably benign 0.32
R7122:Lhx5 UTSW 5 120436345 missense probably benign 0.35
R7439:Lhx5 UTSW 5 120440284 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTCTCAGAGCCACCCAATG -3'
(R):5'- TGCGAGATCATGTCGGTGAATC -3'

Sequencing Primer
(F):5'- CTCGGTCTAACCTAGAATCAGTGG -3'
(R):5'- AGATCATGTCGGTGAATCTGGGG -3'
Posted On2015-10-08