Incidental Mutation 'R4671:Mkrn1'
ID348429
Institutional Source Beutler Lab
Gene Symbol Mkrn1
Ensembl Gene ENSMUSG00000029922
Gene Namemakorin, ring finger protein, 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4671 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location39397804-39420462 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39405757 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 173 (V173A)
Ref Sequence ENSEMBL: ENSMUSP00000110470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031985] [ENSMUST00000051671] [ENSMUST00000114822] [ENSMUST00000114823] [ENSMUST00000146785]
Predicted Effect probably damaging
Transcript: ENSMUST00000031985
AA Change: V173A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031985
Gene: ENSMUSG00000029922
AA Change: V173A

DomainStartEndE-ValueType
low complexity region 2 30 N/A INTRINSIC
low complexity region 35 54 N/A INTRINSIC
ZnF_C3H1 55 81 3.86e-7 SMART
ZnF_C3H1 85 110 8.27e-7 SMART
low complexity region 122 142 N/A INTRINSIC
ZnF_C3H1 208 234 1.13e-4 SMART
RING 281 334 2.09e-7 SMART
low complexity region 349 363 N/A INTRINSIC
ZnF_C3H1 366 392 2.53e-2 SMART
Pfam:MKRN1_C 400 479 9.1e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000051671
AA Change: V173A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084244
Gene: ENSMUSG00000029922
AA Change: V173A

DomainStartEndE-ValueType
low complexity region 2 30 N/A INTRINSIC
low complexity region 35 54 N/A INTRINSIC
ZnF_C3H1 55 81 3.86e-7 SMART
ZnF_C3H1 85 110 8.27e-7 SMART
low complexity region 122 142 N/A INTRINSIC
ZnF_C3H1 208 234 1.13e-4 SMART
RING 281 328 4.72e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114822
AA Change: V173A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110470
Gene: ENSMUSG00000029922
AA Change: V173A

DomainStartEndE-ValueType
SCOP:d1gkub1 2 30 3e-3 SMART
low complexity region 35 54 N/A INTRINSIC
ZnF_C3H1 55 81 3.86e-7 SMART
ZnF_C3H1 85 110 8.27e-7 SMART
low complexity region 122 142 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114823
AA Change: V109A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110471
Gene: ENSMUSG00000029922
AA Change: V109A

DomainStartEndE-ValueType
ZnF_C3H1 1 17 6.26e1 SMART
ZnF_C3H1 21 46 8.27e-7 SMART
low complexity region 58 78 N/A INTRINSIC
ZnF_C3H1 144 170 1.13e-4 SMART
RING 217 270 2.09e-7 SMART
low complexity region 285 299 N/A INTRINSIC
ZnF_C3H1 302 328 2.53e-2 SMART
low complexity region 378 395 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122874
Predicted Effect unknown
Transcript: ENSMUST00000122996
AA Change: V187A
SMART Domains Protein: ENSMUSP00000115231
Gene: ENSMUSG00000029922
AA Change: V187A

DomainStartEndE-ValueType
low complexity region 1 15 N/A INTRINSIC
ZnF_C3H1 75 96 4.11e-2 SMART
ZnF_C3H1 100 125 8.27e-7 SMART
low complexity region 137 157 N/A INTRINSIC
ZnF_C3H1 223 249 1.13e-4 SMART
RING 296 343 4.72e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000146785
AA Change: V151A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123440
Gene: ENSMUSG00000029922
AA Change: V151A

DomainStartEndE-ValueType
ZnF_C3H1 34 59 1.56e-2 SMART
ZnF_C3H1 63 88 8.27e-7 SMART
low complexity region 100 120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150575
SMART Domains Protein: ENSMUSP00000121563
Gene: ENSMUSG00000029922

DomainStartEndE-ValueType
RING 52 105 2.09e-7 SMART
low complexity region 170 191 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a novel class of zinc finger proteins. The encoded protein functions as a transcriptional co-regulator, and as an E3 ubiquitin ligase that promotes the ubiquitination and proteasomal degradation of target proteins. The protein encoded by this gene is thought to regulate RNA polymerase II-catalyzed transcription. Substrates for this protein's E3 ubiquitin ligase activity include the capsid protein of the West Nile virus and the catalytic subunit of the telomerase ribonucleoprotein. This protein controls cell cycle arrest and apoptosis by regulating p21, a cell cycle regulator, and the tumor suppressor protein p53. Pseudogenes of this gene are present on chromosomes 1, 3, 9, 12 and 20, and on the X chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a gene-trapped allele are viable and fertile, and show normal kidney morphology, eyelid development, and skeletal morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,718,859 I637V probably benign Het
Abcc2 T C 19: 43,800,718 S271P probably benign Het
Acod1 T G 14: 103,047,072 M2R probably benign Het
Adamts20 T C 15: 94,403,325 E106G possibly damaging Het
Adgra3 G A 5: 49,979,368 T661M probably damaging Het
Akap13 T A 7: 75,579,564 C161* probably null Het
Akr1c12 A C 13: 4,273,817 S162A possibly damaging Het
Anks1 C A 17: 28,051,578 H805N probably benign Het
Arhgap22 T C 14: 33,362,543 C260R probably damaging Het
Banf1 T C 19: 5,365,844 R33G probably benign Het
Bcas1 T C 2: 170,384,325 K310R probably damaging Het
Cacna1c G T 6: 118,652,058 H1240N probably damaging Het
Cartpt C T 13: 99,900,080 probably null Het
Ccdc127 T A 13: 74,357,045 Y237* probably null Het
Ccnb1ip1 A T 14: 50,792,277 Y109* probably null Het
Cenpj A T 14: 56,553,383 V403E possibly damaging Het
Cps1 A G 1: 67,196,560 Y951C probably damaging Het
Dcakd T C 11: 102,999,808 E51G possibly damaging Het
Dennd4a A T 9: 64,894,407 N944I probably benign Het
Dus3l C T 17: 56,768,566 R430C probably benign Het
Dync2h1 A G 9: 7,169,640 L279P possibly damaging Het
Dzip3 G A 16: 48,979,590 Q112* probably null Het
Eif1ad T A 19: 5,368,191 M1K probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam46c C A 3: 100,473,199 L80F probably benign Het
Fancg T C 4: 43,005,272 E366G probably benign Het
Gin1 C T 1: 97,784,840 P154S probably damaging Het
Gm11938 A T 11: 99,603,006 C88S possibly damaging Het
Gm38394 A G 1: 133,657,040 V853A probably benign Het
Gpr183 T C 14: 121,954,737 D124G probably damaging Het
Gucy2g T A 19: 55,238,068 I139F probably damaging Het
Iqub A T 6: 24,479,184 M453K probably benign Het
Jcad A G 18: 4,674,175 T646A probably benign Het
Kif23 A T 9: 61,945,359 D24E probably benign Het
Kmt2c T C 5: 25,366,177 N845S probably damaging Het
Lhx5 G A 5: 120,439,967 S284N probably benign Het
Lipf T G 19: 33,976,676 V389G possibly damaging Het
Lrrc7 C T 3: 158,202,495 probably null Het
Magi1 A G 6: 93,680,787 probably null Het
Mast2 A G 4: 116,308,650 S1287P probably damaging Het
Mepce C T 5: 137,786,643 probably benign Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Naip6 A G 13: 100,294,731 probably null Het
Nsmce3 A T 7: 64,872,782 L46Q probably benign Het
Olfr1294 A T 2: 111,537,935 M118K probably damaging Het
Olfr354 G A 2: 36,907,393 C149Y probably benign Het
Olfr531 T G 7: 140,400,305 Y247S probably damaging Het
Olfr681 T C 7: 105,122,306 L283P probably damaging Het
Olfr78 A G 7: 102,742,601 V134A probably damaging Het
Parp14 A G 16: 35,858,321 F426L probably benign Het
Pcf11 A T 7: 92,657,529 S1144T possibly damaging Het
Prpf3 T A 3: 95,851,664 T59S possibly damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptk7 A G 17: 46,574,466 V678A probably benign Het
Rb1 A G 14: 73,273,676 L331S probably damaging Het
Sell A G 1: 164,065,473 Y86C probably damaging Het
Serpina1e G A 12: 103,948,082 R328W probably damaging Het
Sertad3 T G 7: 27,476,666 L175R possibly damaging Het
Stard9 G T 2: 120,698,640 G1793W probably damaging Het
Stra6 T C 9: 58,149,234 I383T probably benign Het
Tcf7l1 A G 6: 72,649,178 L154P probably damaging Het
Tonsl A T 15: 76,623,410 D55E probably benign Het
Ttc21b A G 2: 66,226,913 S572P possibly damaging Het
Ttc7 T A 17: 87,346,620 L575Q probably damaging Het
Ubl4b C T 3: 107,554,878 S22N probably damaging Het
Ubr4 T C 4: 139,436,191 V2634A possibly damaging Het
Zfp46 A C 4: 136,290,173 D106A probably damaging Het
Zfp951 A C 5: 104,814,701 I333S probably benign Het
Other mutations in Mkrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01921:Mkrn1 APN 6 39405913 missense possibly damaging 0.80
IGL03235:Mkrn1 APN 6 39401330 missense probably damaging 1.00
R0127:Mkrn1 UTSW 6 39399275 missense probably benign 0.19
R0445:Mkrn1 UTSW 6 39404854 missense probably benign 0.28
R1109:Mkrn1 UTSW 6 39399334 missense probably damaging 1.00
R1366:Mkrn1 UTSW 6 39405917 missense probably benign 0.02
R1783:Mkrn1 UTSW 6 39400456 missense probably null
R2002:Mkrn1 UTSW 6 39405803 missense probably benign 0.00
R4889:Mkrn1 UTSW 6 39420005 unclassified probably benign
Z1088:Mkrn1 UTSW 6 39400456 missense probably null
Predicted Primers PCR Primer
(F):5'- AGCATTCGGAGACACTTCAG -3'
(R):5'- GTGACTGCTACTGATCTGAGTG -3'

Sequencing Primer
(F):5'- CGGAGACACTTCAGTTTTTAAACAAG -3'
(R):5'- GACTGCTACTGATCTGAGTGCAAAAC -3'
Posted On2015-10-08