Incidental Mutation 'R4671:Adamts20'
ID348464
Institutional Source Beutler Lab
Gene Symbol Adamts20
Ensembl Gene ENSMUSG00000022449
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20
SynonymsADAMTS-20, bt
Accession Numbers

Genbank: NM_177431; MGI: 2660628

Is this an essential gene? Possibly non essential (E-score: 0.358) question?
Stock #R4671 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location94270163-94465418 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94403325 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 106 (E106G)
Ref Sequence ENSEMBL: ENSMUSP00000036330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035342] [ENSMUST00000155907]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035342
AA Change: E106G

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000036330
Gene: ENSMUSG00000022449
AA Change: E106G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Pep_M12B_propep 41 186 1.4e-30 PFAM
Pfam:Reprolysin_5 253 445 3.6e-13 PFAM
Pfam:Reprolysin_4 253 460 1.1e-7 PFAM
Pfam:Reprolysin 255 464 1.5e-26 PFAM
Pfam:Reprolysin_2 272 454 1.8e-10 PFAM
Pfam:Reprolysin_3 276 410 5.8e-10 PFAM
TSP1 556 608 7.73e-11 SMART
Pfam:ADAM_spacer1 718 836 2.6e-34 PFAM
TSP1 846 901 1.47e-1 SMART
TSP1 904 958 2.83e0 SMART
TSP1 965 1019 4.28e-4 SMART
TSP1 1020 1074 1.89e-5 SMART
TSP1 1075 1131 4.87e-8 SMART
TSP1 1152 1201 6.05e-4 SMART
TSP1 1204 1260 1.22e-8 SMART
TSP1 1304 1356 1.37e-2 SMART
TSP1 1357 1411 6e-8 SMART
TSP1 1416 1470 1.69e-2 SMART
TSP1 1471 1526 2.3e0 SMART
TSP1 1530 1579 1.23e0 SMART
TSP1 1653 1706 5.27e-4 SMART
Pfam:GON 1708 1905 5.8e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129195
Predicted Effect possibly damaging
Transcript: ENSMUST00000155907
AA Change: E106G

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000121696
Gene: ENSMUSG00000022449
AA Change: E106G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Pep_M12B_propep 40 186 1e-31 PFAM
Pfam:Reprolysin_5 253 445 2.7e-13 PFAM
Pfam:Reprolysin_4 253 460 7.2e-8 PFAM
Pfam:Reprolysin 255 464 2.4e-28 PFAM
Pfam:Reprolysin_2 272 454 4e-10 PFAM
Pfam:Reprolysin_3 276 410 1.1e-10 PFAM
TSP1 556 608 7.73e-11 SMART
Pfam:ADAM_spacer1 718 836 2e-34 PFAM
TSP1 846 901 1.47e-1 SMART
TSP1 904 958 2.83e0 SMART
TSP1 965 1019 4.28e-4 SMART
TSP1 1020 1074 1.89e-5 SMART
TSP1 1075 1131 4.87e-8 SMART
TSP1 1152 1201 6.05e-4 SMART
TSP1 1204 1260 1.22e-8 SMART
TSP1 1304 1356 1.37e-2 SMART
TSP1 1357 1411 6e-8 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Certain mutations in this gene cause defective development of neural crest-derived melanoblasts resulting in a "belted" phenotype that is characterized by white spots in the lumbar region. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for spontaneous or ENU-induced mutations exhibit abnormal coat/hair pigmentation, including a typical white belt phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(17) : Targeted, other(1) Spontaneous(11) Chemically induced(5)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,718,859 I637V probably benign Het
Abcc2 T C 19: 43,800,718 S271P probably benign Het
Acod1 T G 14: 103,047,072 M2R probably benign Het
Adgra3 G A 5: 49,979,368 T661M probably damaging Het
Akap13 T A 7: 75,579,564 C161* probably null Het
Akr1c12 A C 13: 4,273,817 S162A possibly damaging Het
Anks1 C A 17: 28,051,578 H805N probably benign Het
Arhgap22 T C 14: 33,362,543 C260R probably damaging Het
Banf1 T C 19: 5,365,844 R33G probably benign Het
Bcas1 T C 2: 170,384,325 K310R probably damaging Het
Cacna1c G T 6: 118,652,058 H1270N probably damaging Het
Cartpt C T 13: 99,900,080 probably null Het
Ccdc127 T A 13: 74,357,045 Y237* probably null Het
Ccnb1ip1 A T 14: 50,792,277 Y109* probably null Het
Cenpj A T 14: 56,553,383 V403E possibly damaging Het
Cps1 A G 1: 67,196,560 Y951C probably damaging Het
Dcakd T C 11: 102,999,808 E51G possibly damaging Het
Dennd4a A T 9: 64,894,407 N944I probably benign Het
Dus3l C T 17: 56,768,566 R430C probably benign Het
Dync2h1 A G 9: 7,169,640 L279P possibly damaging Het
Dzip3 G A 16: 48,979,590 Q112* probably null Het
Eif1ad T A 19: 5,368,191 M1K probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam46c C A 3: 100,473,199 L80F probably benign Het
Fancg T C 4: 43,005,272 E366G probably benign Het
Gin1 C T 1: 97,784,840 P154S probably damaging Het
Gm11938 A T 11: 99,603,006 C88S possibly damaging Het
Gm38394 A G 1: 133,657,040 V853A probably benign Het
Gpr183 T C 14: 121,954,737 D124G probably damaging Het
Gucy2g T A 19: 55,238,068 I139F probably damaging Het
Iqub A T 6: 24,479,184 M453K probably benign Het
Jcad A G 18: 4,674,175 T646A probably benign Het
Kif23 A T 9: 61,945,359 D24E probably benign Het
Kmt2c T C 5: 25,366,177 N845S probably damaging Het
Lhx5 G A 5: 120,439,967 S284N probably benign Het
Lipf T G 19: 33,976,676 V389G possibly damaging Het
Lrrc7 C T 3: 158,202,495 probably null Het
Magi1 A G 6: 93,680,787 probably null Het
Mast2 A G 4: 116,308,650 S1287P probably damaging Het
Mepce C T 5: 137,786,643 G24D probably benign Het
Mkrn1 A G 6: 39,405,757 V173A probably damaging Het
Myo1c C T 11: 75,670,030 R789* probably null Het
Naip6 A G 13: 100,294,731 probably null Het
Nsmce3 A T 7: 64,872,782 L46Q probably benign Het
Olfr1294 A T 2: 111,537,935 M118K probably damaging Het
Olfr354 G A 2: 36,907,393 C149Y probably benign Het
Olfr531 T G 7: 140,400,305 Y247S probably damaging Het
Olfr681 T C 7: 105,122,306 L283P probably damaging Het
Olfr78 A G 7: 102,742,601 V134A probably damaging Het
Parp14 A G 16: 35,858,321 F426L probably benign Het
Pcf11 A T 7: 92,657,529 S1144T possibly damaging Het
Prpf3 T A 3: 95,851,664 T59S possibly damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptk7 A G 17: 46,574,466 V678A probably benign Het
Rb1 A G 14: 73,273,676 L331S probably damaging Het
Sell A G 1: 164,065,473 Y86C probably damaging Het
Serpina1e G A 12: 103,948,082 R328W probably damaging Het
Sertad3 T G 7: 27,476,666 L175R possibly damaging Het
Stard9 G T 2: 120,698,640 G1793W probably damaging Het
Stra6 T C 9: 58,149,234 I383T probably benign Het
Tcf7l1 A G 6: 72,649,178 L154P probably damaging Het
Tonsl A T 15: 76,623,410 D55E probably benign Het
Ttc21b A G 2: 66,226,913 S572P possibly damaging Het
Ttc7 T A 17: 87,346,620 L575Q probably damaging Het
Ubl4b C T 3: 107,554,878 S22N probably damaging Het
Ubr4 T C 4: 139,436,191 V2634A possibly damaging Het
Zfp46 A C 4: 136,290,173 D106A probably damaging Het
Zfp951 A C 5: 104,814,701 I333S probably benign Het
Other mutations in Adamts20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Adamts20 APN 15 94394641 missense probably benign
IGL00491:Adamts20 APN 15 94273232 missense possibly damaging 0.89
IGL00502:Adamts20 APN 15 94403397 missense probably damaging 0.99
IGL00672:Adamts20 APN 15 94341105 missense probably damaging 0.99
IGL00840:Adamts20 APN 15 94282482 missense probably damaging 1.00
IGL00909:Adamts20 APN 15 94379813 missense probably damaging 1.00
IGL01101:Adamts20 APN 15 94344042 missense probably damaging 1.00
IGL01137:Adamts20 APN 15 94394611 unclassified probably null
IGL01457:Adamts20 APN 15 94331448 missense probably damaging 0.97
IGL01685:Adamts20 APN 15 94403446 missense possibly damaging 0.81
IGL01949:Adamts20 APN 15 94326106 missense probably benign 0.08
IGL02525:Adamts20 APN 15 94283078 unclassified probably null
IGL03088:Adamts20 APN 15 94329914 unclassified probably null
IGL03175:Adamts20 APN 15 94273255 nonsense probably null
belt UTSW 15 94345990 missense probably damaging 1.00
buckeye UTSW 15 94341087 missense probably damaging 1.00
jack_white UTSW 15 unclassified
Meowth UTSW 15 94331458 missense probably damaging 1.00
nidoking UTSW 15 94403445 missense probably damaging 1.00
panda UTSW 15 94326699 nonsense
pikachu UTSW 15 94345990 missense probably damaging 1.00
poliwag UTSW 15 94394622 nonsense probably null
splotch2 UTSW 15 94335561 splice acceptor site
wash UTSW 15 94347670 nonsense probably null
whitebelly UTSW 15 unclassified
whopper UTSW 15 94347810 missense
R0483:Adamts20 UTSW 15 94353571 missense probably benign 0.00
R0514:Adamts20 UTSW 15 94270376 missense probably damaging 1.00
R0568:Adamts20 UTSW 15 94291713 splice site probably benign
R0730:Adamts20 UTSW 15 94347690 missense probably benign 0.00
R0973:Adamts20 UTSW 15 94286371 missense probably benign 0.00
R1339:Adamts20 UTSW 15 94322896 missense probably benign 0.19
R1721:Adamts20 UTSW 15 94338459 missense probably benign 0.44
R1809:Adamts20 UTSW 15 94341087 missense probably damaging 1.00
R1832:Adamts20 UTSW 15 94286344 missense probably benign 0.00
R1846:Adamts20 UTSW 15 94345990 missense probably damaging 1.00
R1867:Adamts20 UTSW 15 94338459 missense probably benign 0.44
R1875:Adamts20 UTSW 15 94331396 missense probably benign 0.01
R1930:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R1931:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R1932:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R2001:Adamts20 UTSW 15 94347718 missense possibly damaging 0.96
R2116:Adamts20 UTSW 15 94355362 missense probably damaging 1.00
R2162:Adamts20 UTSW 15 94331458 missense probably damaging 1.00
R2350:Adamts20 UTSW 15 94283916 missense probably damaging 1.00
R2887:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R2889:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R2890:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R3109:Adamts20 UTSW 15 94345904 splice site probably benign
R3719:Adamts20 UTSW 15 94361838 missense probably damaging 0.99
R3832:Adamts20 UTSW 15 94331458 missense probably damaging 1.00
R3901:Adamts20 UTSW 15 94328845 missense possibly damaging 0.81
R4398:Adamts20 UTSW 15 94333695 missense possibly damaging 0.93
R4402:Adamts20 UTSW 15 94379946 missense probably benign
R4431:Adamts20 UTSW 15 94344043 missense probably damaging 1.00
R4479:Adamts20 UTSW 15 94403445 missense probably damaging 1.00
R4482:Adamts20 UTSW 15 94345920 missense probably damaging 1.00
R4503:Adamts20 UTSW 15 94379750 missense probably damaging 0.99
R4700:Adamts20 UTSW 15 94394622 nonsense probably null
R4707:Adamts20 UTSW 15 94333647 missense possibly damaging 0.53
R4725:Adamts20 UTSW 15 94351762 missense probably damaging 0.99
R4771:Adamts20 UTSW 15 94351635 splice site probably null
R4829:Adamts20 UTSW 15 94326396 missense probably benign 0.01
R4937:Adamts20 UTSW 15 94379775 missense probably benign
R4960:Adamts20 UTSW 15 94379774 missense probably benign
R5270:Adamts20 UTSW 15 94282519 missense probably benign 0.00
R5388:Adamts20 UTSW 15 94345778 missense possibly damaging 0.81
R5410:Adamts20 UTSW 15 94281957 missense possibly damaging 0.94
R5453:Adamts20 UTSW 15 94326088 missense possibly damaging 0.69
R5611:Adamts20 UTSW 15 94273280 missense possibly damaging 0.65
R5687:Adamts20 UTSW 15 94325971 missense probably benign 0.36
R5758:Adamts20 UTSW 15 94394650 missense probably benign 0.00
R5801:Adamts20 UTSW 15 94347670 nonsense probably null
R5834:Adamts20 UTSW 15 94353584 missense probably damaging 0.99
R5993:Adamts20 UTSW 15 94338723 missense probably damaging 0.99
R5997:Adamts20 UTSW 15 94379747 missense probably damaging 1.00
R6044:Adamts20 UTSW 15 94282483 missense probably damaging 1.00
R6058:Adamts20 UTSW 15 94330047 nonsense probably null
R6217:Adamts20 UTSW 15 94338715 missense probably benign 0.00
R6283:Adamts20 UTSW 15 94351721 missense probably benign
R6354:Adamts20 UTSW 15 94347810 missense probably damaging 1.00
R6415:Adamts20 UTSW 15 94324659 critical splice donor site probably null
R6417:Adamts20 UTSW 15 94333675 missense possibly damaging 0.84
R6476:Adamts20 UTSW 15 94361810 missense probably benign 0.22
R6485:Adamts20 UTSW 15 94343971 missense probably benign 0.17
R6517:Adamts20 UTSW 15 94283104 intron probably null
R6675:Adamts20 UTSW 15 94331316 critical splice donor site probably null
R6863:Adamts20 UTSW 15 94379746 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGGCCTGGATCAGAGAAAAC -3'
(R):5'- AAGCCCTGGTGAAGACTCTG -3'

Sequencing Primer
(F):5'- CTCATAGGGAGGTACAATCAGGC -3'
(R):5'- ACGCGGGTCAATGAGTTC -3'
Posted OnOct 08, 2015