Incidental Mutation 'R4671:Ttc7'
ID348472
Institutional Source Beutler Lab
Gene Symbol Ttc7
Ensembl Gene ENSMUSG00000036918
Gene Nametetratricopeptide repeat domain 7
Synonyms1110035E02Rik, fsn, hea, 1700007L07Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.742) question?
Stock #R4671 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location87282886-87381769 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87346620 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 575 (L575Q)
Ref Sequence ENSEMBL: ENSMUSP00000115351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041110] [ENSMUST00000125875] [ENSMUST00000144204] [ENSMUST00000154255]
Predicted Effect probably damaging
Transcript: ENSMUST00000041110
AA Change: L575Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040771
Gene: ENSMUSG00000036918
AA Change: L575Q

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
low complexity region 68 76 N/A INTRINSIC
Pfam:TPR_9 387 458 8.7e-4 PFAM
Blast:TPR 488 532 7e-20 BLAST
Blast:TPR 534 566 3e-7 BLAST
TPR 567 600 1.11e1 SMART
low complexity region 666 684 N/A INTRINSIC
TPR 711 744 7.89e1 SMART
TPR 745 778 3.87e-2 SMART
TPR 779 812 9.99e1 SMART
TPR 813 846 1.39e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125875
AA Change: L575Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115351
Gene: ENSMUSG00000036918
AA Change: L575Q

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
low complexity region 68 76 N/A INTRINSIC
Pfam:TPR_9 387 458 1.2e-3 PFAM
Blast:TPR 488 532 7e-20 BLAST
Blast:TPR 534 566 3e-7 BLAST
TPR 567 600 1.11e1 SMART
low complexity region 666 684 N/A INTRINSIC
TPR 711 744 7.89e1 SMART
TPR 745 778 3.87e-2 SMART
low complexity region 787 801 N/A INTRINSIC
low complexity region 806 818 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144204
SMART Domains Protein: ENSMUSP00000122563
Gene: ENSMUSG00000036918

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
low complexity region 68 76 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154255
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing tetratricopeptide repeats. Mutations in this gene disrupt intestinal development and can cause early onset inflammatory bowel disease and intestinal atresia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit reduced growth, sparse hair, thickened, scaly skin, increased numbers of splenic B cells, macrophages, and erythroid cells, elevated IgE, glomerulonephritis, and forestomach papillomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,718,859 I637V probably benign Het
Abcc2 T C 19: 43,800,718 S271P probably benign Het
Acod1 T G 14: 103,047,072 M2R probably benign Het
Adamts20 T C 15: 94,403,325 E106G possibly damaging Het
Adgra3 G A 5: 49,979,368 T661M probably damaging Het
Akap13 T A 7: 75,579,564 C161* probably null Het
Akr1c12 A C 13: 4,273,817 S162A possibly damaging Het
Anks1 C A 17: 28,051,578 H805N probably benign Het
Arhgap22 T C 14: 33,362,543 C260R probably damaging Het
Banf1 T C 19: 5,365,844 R33G probably benign Het
Bcas1 T C 2: 170,384,325 K310R probably damaging Het
Cacna1c G T 6: 118,652,058 H1240N probably damaging Het
Cartpt C T 13: 99,900,080 probably null Het
Ccdc127 T A 13: 74,357,045 Y237* probably null Het
Ccnb1ip1 A T 14: 50,792,277 Y109* probably null Het
Cenpj A T 14: 56,553,383 V403E possibly damaging Het
Cps1 A G 1: 67,196,560 Y951C probably damaging Het
Dcakd T C 11: 102,999,808 E51G possibly damaging Het
Dennd4a A T 9: 64,894,407 N944I probably benign Het
Dus3l C T 17: 56,768,566 R430C probably benign Het
Dync2h1 A G 9: 7,169,640 L279P possibly damaging Het
Dzip3 G A 16: 48,979,590 Q112* probably null Het
Eif1ad T A 19: 5,368,191 M1K probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam46c C A 3: 100,473,199 L80F probably benign Het
Fancg T C 4: 43,005,272 E366G probably benign Het
Gin1 C T 1: 97,784,840 P154S probably damaging Het
Gm11938 A T 11: 99,603,006 C88S possibly damaging Het
Gm38394 A G 1: 133,657,040 V853A probably benign Het
Gpr183 T C 14: 121,954,737 D124G probably damaging Het
Gucy2g T A 19: 55,238,068 I139F probably damaging Het
Iqub A T 6: 24,479,184 M453K probably benign Het
Jcad A G 18: 4,674,175 T646A probably benign Het
Kif23 A T 9: 61,945,359 D24E probably benign Het
Kmt2c T C 5: 25,366,177 N845S probably damaging Het
Lhx5 G A 5: 120,439,967 S284N probably benign Het
Lipf T G 19: 33,976,676 V389G possibly damaging Het
Lrrc7 C T 3: 158,202,495 probably null Het
Magi1 A G 6: 93,680,787 probably null Het
Mast2 A G 4: 116,308,650 S1287P probably damaging Het
Mepce C T 5: 137,786,643 probably benign Het
Mkrn1 A G 6: 39,405,757 V173A probably damaging Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Naip6 A G 13: 100,294,731 probably null Het
Nsmce3 A T 7: 64,872,782 L46Q probably benign Het
Olfr1294 A T 2: 111,537,935 M118K probably damaging Het
Olfr354 G A 2: 36,907,393 C149Y probably benign Het
Olfr531 T G 7: 140,400,305 Y247S probably damaging Het
Olfr681 T C 7: 105,122,306 L283P probably damaging Het
Olfr78 A G 7: 102,742,601 V134A probably damaging Het
Parp14 A G 16: 35,858,321 F426L probably benign Het
Pcf11 A T 7: 92,657,529 S1144T possibly damaging Het
Prpf3 T A 3: 95,851,664 T59S possibly damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptk7 A G 17: 46,574,466 V678A probably benign Het
Rb1 A G 14: 73,273,676 L331S probably damaging Het
Sell A G 1: 164,065,473 Y86C probably damaging Het
Serpina1e G A 12: 103,948,082 R328W probably damaging Het
Sertad3 T G 7: 27,476,666 L175R possibly damaging Het
Stard9 G T 2: 120,698,640 G1793W probably damaging Het
Stra6 T C 9: 58,149,234 I383T probably benign Het
Tcf7l1 A G 6: 72,649,178 L154P probably damaging Het
Tonsl A T 15: 76,623,410 D55E probably benign Het
Ttc21b A G 2: 66,226,913 S572P possibly damaging Het
Ubl4b C T 3: 107,554,878 S22N probably damaging Het
Ubr4 T C 4: 139,436,191 V2634A possibly damaging Het
Zfp46 A C 4: 136,290,173 D106A probably damaging Het
Zfp951 A C 5: 104,814,701 I333S probably benign Het
Other mutations in Ttc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Ttc7 APN 17 87363564 missense possibly damaging 0.66
IGL00980:Ttc7 APN 17 87321446 missense possibly damaging 0.82
IGL01638:Ttc7 APN 17 87359112 critical splice acceptor site probably null
IGL01896:Ttc7 APN 17 87359124 missense probably damaging 0.99
IGL02643:Ttc7 APN 17 87340899 missense possibly damaging 0.85
R0164:Ttc7 UTSW 17 87379895 missense probably damaging 1.00
R0164:Ttc7 UTSW 17 87379895 missense probably damaging 1.00
R0310:Ttc7 UTSW 17 87361864 missense probably benign 0.00
R0412:Ttc7 UTSW 17 87330044 missense probably benign 0.20
R0520:Ttc7 UTSW 17 87359151 missense possibly damaging 0.93
R1216:Ttc7 UTSW 17 87346578 missense possibly damaging 0.85
R1262:Ttc7 UTSW 17 87340936 missense probably benign 0.09
R1337:Ttc7 UTSW 17 87290296 missense probably damaging 1.00
R1537:Ttc7 UTSW 17 87322463 missense possibly damaging 0.88
R1586:Ttc7 UTSW 17 87361945 critical splice donor site probably null
R1678:Ttc7 UTSW 17 87361901 missense probably damaging 1.00
R1747:Ttc7 UTSW 17 87307015 missense possibly damaging 0.87
R2146:Ttc7 UTSW 17 87346707 splice site probably benign
R3878:Ttc7 UTSW 17 87370738 intron probably benign
R3934:Ttc7 UTSW 17 87370738 intron probably benign
R4007:Ttc7 UTSW 17 87290251 missense possibly damaging 0.69
R4256:Ttc7 UTSW 17 87321401 critical splice acceptor site probably null
R4676:Ttc7 UTSW 17 87370735 intron probably benign
R4677:Ttc7 UTSW 17 87370735 intron probably benign
R4784:Ttc7 UTSW 17 87340897 missense probably benign 0.03
R4833:Ttc7 UTSW 17 87334321 missense probably damaging 1.00
R4927:Ttc7 UTSW 17 87346705 splice site probably null
R4940:Ttc7 UTSW 17 87306958 missense probably benign 0.02
R5183:Ttc7 UTSW 17 87292878 missense probably damaging 1.00
R5634:Ttc7 UTSW 17 87342087 missense probably benign
R5710:Ttc7 UTSW 17 87290246 missense probably damaging 1.00
R5867:Ttc7 UTSW 17 87322472 missense possibly damaging 0.49
R6437:Ttc7 UTSW 17 87330106 missense probably damaging 1.00
R6982:Ttc7 UTSW 17 87307009 missense probably damaging 1.00
R7299:Ttc7 UTSW 17 87346542 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- CAAGATGCTTGCTTCTGGTG -3'
(R):5'- TGCTCTGCTCACAGTGTCTATG -3'

Sequencing Primer
(F):5'- TGTCCCAGGCTGACTTGAG -3'
(R):5'- CTCACAGTGTCTATGCAGTGGAC -3'
Posted On2015-10-08