Incidental Mutation 'R4672:Rasal2'
ID348488
Institutional Source Beutler Lab
Gene Symbol Rasal2
Ensembl Gene ENSMUSG00000070565
Gene NameRAS protein activator like 2
SynonymsA330066M24Rik
MMRRC Submission 041927-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R4672 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location157135182-157412595 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 157243661 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 41 (F41S)
Ref Sequence ENSEMBL: ENSMUSP00000118367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078308] [ENSMUST00000129880] [ENSMUST00000132699] [ENSMUST00000134543]
Predicted Effect probably benign
Transcript: ENSMUST00000078308
SMART Domains Protein: ENSMUSP00000077423
Gene: ENSMUSG00000070565

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
PH 58 307 3.97e-8 SMART
C2 317 413 6.01e-10 SMART
RasGAP 423 767 4.56e-157 SMART
low complexity region 780 791 N/A INTRINSIC
low complexity region 1063 1075 N/A INTRINSIC
low complexity region 1084 1092 N/A INTRINSIC
coiled coil region 1117 1236 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129880
AA Change: F41S

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000118367
Gene: ENSMUSG00000070565
AA Change: F41S

DomainStartEndE-ValueType
PH 128 243 8.46e-3 SMART
Pfam:C2 252 323 1.7e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132699
SMART Domains Protein: ENSMUSP00000114964
Gene: ENSMUSG00000070565

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
PH 40 289 1.7e-10 SMART
C2 299 395 4e-12 SMART
RasGAP 405 742 4.2e-153 SMART
low complexity region 755 766 N/A INTRINSIC
low complexity region 1038 1050 N/A INTRINSIC
low complexity region 1059 1067 N/A INTRINSIC
coiled coil region 1092 1211 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134543
SMART Domains Protein: ENSMUSP00000119623
Gene: ENSMUSG00000070565

DomainStartEndE-ValueType
PH 45 160 8.46e-3 SMART
Meta Mutation Damage Score 0.1124 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (113/115)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains the GAP-related domain (GRD), a characteristic domain of GTPase-activating proteins (GAPs). GAPs function as activators of Ras superfamily of small GTPases. The protein encoded by this gene is able to complement the defective RasGAP function in a yeast system. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit reduced survival and decreased tumor latency. In other tumorigenic models, this allele promotes increase metastatic potential. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,889,990 *330W probably null Het
Abca8a G A 11: 110,071,876 L483F possibly damaging Het
Abca8b A G 11: 109,936,448 F1507L possibly damaging Het
Adamdec1 C A 14: 68,577,904 E104* probably null Het
Adamts16 G A 13: 70,779,518 probably benign Het
AI464131 T A 4: 41,499,061 M190L probably benign Het
Alppl2 T C 1: 87,089,465 probably benign Het
Aplnr A G 2: 85,137,180 Y183C probably damaging Het
Atm G A 9: 53,522,201 R250W probably damaging Het
B4galt7 T C 13: 55,609,319 L275P probably damaging Het
C87414 T A 5: 93,636,323 R230S probably damaging Het
Ccdc178 G A 18: 22,150,444 Q10* probably null Het
Ccr9 T C 9: 123,779,687 Y145H probably damaging Het
Cd209f C T 8: 4,103,685 G188D probably damaging Het
Cep70 T A 9: 99,254,312 S23T possibly damaging Het
Cpped1 C A 16: 11,805,374 E294* probably null Het
Crisp1 T A 17: 40,294,513 probably null Het
Disp1 T C 1: 183,098,651 probably null Het
Dlg2 A T 7: 92,286,535 M624L probably damaging Het
Elf2 A G 3: 51,256,434 V558A probably damaging Het
Eno2 T C 6: 124,766,146 D209G probably damaging Het
Fam187b G A 7: 30,977,543 R159H probably damaging Het
Fh1 G A 1: 175,604,051 A423V probably benign Het
Frg1 C T 8: 41,400,809 D164N probably benign Het
Fsbp T G 4: 11,579,841 N36K probably benign Het
Gcn1l1 A G 5: 115,606,520 T1592A probably damaging Het
Gimap3 A G 6: 48,765,753 I81T probably damaging Het
Gjb6 C T 14: 57,124,778 V9I probably benign Het
Gkap1 T C 13: 58,263,956 S68G possibly damaging Het
Gm8765 T C 13: 50,703,172 Y949H probably benign Het
Gpatch8 A T 11: 102,478,958 S1251R probably damaging Het
Gria4 A G 9: 4,664,981 F92L possibly damaging Het
H2-Q1 C A 17: 35,320,930 D58E probably damaging Het
Hs1bp3 G T 12: 8,341,983 G362* probably null Het
Igfn1 T A 1: 135,965,369 H2114L possibly damaging Het
Igkv12-98 A G 6: 68,570,956 Q22R probably benign Het
Ing3 A G 6: 21,965,730 probably null Het
Insr C T 8: 3,167,501 probably null Het
Kdm3b T C 18: 34,808,577 S374P probably benign Het
Kif14 A C 1: 136,521,278 Q1472P probably benign Het
Kif14 G T 1: 136,521,279 Q1472H probably benign Het
Knstrn A G 2: 118,834,031 E202G probably damaging Het
Knstrn G T 2: 118,834,032 E202D possibly damaging Het
Krt12 A G 11: 99,418,683 probably benign Het
Lgi3 A T 14: 70,534,457 I195F possibly damaging Het
Lima1 T C 15: 99,843,709 N29D probably damaging Het
Liph T C 16: 21,984,056 I88V probably benign Het
Lrrk1 A G 7: 66,279,372 S86P probably benign Het
Lsamp A G 16: 41,955,334 R166G probably damaging Het
Mamdc2 T A 19: 23,350,784 N407Y probably damaging Het
Mast3 CATA CA 8: 70,784,797 probably null Het
Megf6 T A 4: 154,249,452 N212K probably damaging Het
Met A C 6: 17,571,804 D1374A probably benign Het
Mrc2 A G 11: 105,343,097 T902A probably benign Het
Mroh3 T A 1: 136,190,975 T535S probably benign Het
Muc1 G T 3: 89,232,077 V595L probably damaging Het
Myh2 T A 11: 67,188,477 L957Q probably damaging Het
Ncl A T 1: 86,356,602 D257E probably benign Het
Nipbl T A 15: 8,302,984 D2263V probably damaging Het
Olfr1290 A T 2: 111,489,557 N200K possibly damaging Het
Olfr727 A G 14: 50,127,257 N227D probably benign Het
Olfr855 A G 9: 19,585,430 K298E possibly damaging Het
Optc C A 1: 133,897,817 V324L possibly damaging Het
Osbpl9 A G 4: 109,064,609 I604T possibly damaging Het
Otog C A 7: 46,289,786 A2080D probably damaging Het
Parp6 G C 9: 59,640,110 R460P probably damaging Het
Phactr4 G T 4: 132,370,706 P417Q probably damaging Het
Pigt T C 2: 164,497,578 probably benign Het
Plekha5 A G 6: 140,524,929 I99V probably damaging Het
Plxna3 T G X: 74,338,948 probably null Het
Ppp2r1b G A 9: 50,867,719 M362I probably damaging Het
Rad51 A G 2: 119,123,846 I136V probably benign Het
Rad54b T A 4: 11,609,449 H633Q probably benign Het
Reep3 T A 10: 67,021,850 H154L probably benign Het
Rp1l1 T G 14: 64,031,270 V1435G probably damaging Het
Rps6ka5 C A 12: 100,654,287 K125N possibly damaging Het
Rsad1 A T 11: 94,543,618 M330K probably damaging Het
Scand1 A G 2: 156,311,930 probably null Het
Setd6 A G 8: 95,718,012 H111R probably null Het
Slc27a3 T C 3: 90,387,646 N368S possibly damaging Het
Slc38a2 T C 15: 96,698,637 T32A probably benign Het
Smg7 A G 1: 152,845,413 S683P probably damaging Het
Smyd2 A T 1: 189,909,904 L62M probably damaging Het
Sox5 T C 6: 143,833,349 Y687C probably damaging Het
Spaca6 T A 17: 17,836,743 C53* probably null Het
Spire2 T C 8: 123,358,111 V230A probably benign Het
Sptbn2 G T 19: 4,732,496 V487L probably benign Het
Stk3 T A 15: 35,099,457 I110L probably benign Het
Stox2 T A 8: 47,192,106 Y773F probably damaging Het
Tbrg1 C A 9: 37,651,336 A259S probably damaging Het
Tnfsf18 C A 1: 161,503,738 D152E probably benign Het
Tpr G A 1: 150,423,567 A1173T probably benign Het
Trrap T C 5: 144,785,480 L271P probably damaging Het
Ttn G T 2: 76,827,075 probably benign Het
U2surp A G 9: 95,493,145 S192P possibly damaging Het
Ubr4 C T 4: 139,410,716 S1128L probably damaging Het
Ucma G A 2: 4,976,654 probably null Het
Urb1 A T 16: 90,772,634 D1401E probably benign Het
Usp54 A T 14: 20,581,529 probably benign Het
Vmn1r31 A G 6: 58,472,071 Y270H probably damaging Het
Vmn1r90 T A 7: 14,561,568 T202S probably benign Het
Vmn2r88 A G 14: 51,418,155 Y616C probably damaging Het
Vmn2r95 T A 17: 18,452,151 W717R probably damaging Het
Zcchc4 C A 5: 52,796,605 T209K probably benign Het
Zfp955b T A 17: 33,305,259 probably benign Het
Other mutations in Rasal2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Rasal2 APN 1 157147817 missense probably benign
IGL00484:Rasal2 APN 1 157174175 unclassified probably null
IGL00731:Rasal2 APN 1 157157764 missense probably benign 0.01
IGL00900:Rasal2 APN 1 157411929 missense possibly damaging 0.73
IGL01346:Rasal2 APN 1 157161216 missense probably benign 0.19
IGL01635:Rasal2 APN 1 157163824 missense probably damaging 1.00
IGL01759:Rasal2 APN 1 157175932 missense probably benign 0.42
IGL01939:Rasal2 APN 1 157175910 missense probably damaging 1.00
IGL01954:Rasal2 APN 1 157177699 missense possibly damaging 0.83
IGL01954:Rasal2 APN 1 157176116 missense probably damaging 0.99
IGL02005:Rasal2 APN 1 157156998 nonsense probably null
IGL02056:Rasal2 APN 1 157299261 missense probably damaging 0.99
IGL02444:Rasal2 APN 1 157299195 missense probably benign 0.20
IGL02496:Rasal2 APN 1 157149879 missense possibly damaging 0.69
IGL02832:Rasal2 APN 1 157157207 missense probably damaging 1.00
IGL03351:Rasal2 APN 1 157192741 splice site probably benign
R0456:Rasal2 UTSW 1 157149843 missense probably damaging 1.00
R0537:Rasal2 UTSW 1 157147792 missense possibly damaging 0.46
R0681:Rasal2 UTSW 1 157157180 missense possibly damaging 0.70
R0682:Rasal2 UTSW 1 157179209 missense probably damaging 1.00
R0683:Rasal2 UTSW 1 157179209 missense probably damaging 1.00
R0787:Rasal2 UTSW 1 157158696 missense probably damaging 1.00
R0789:Rasal2 UTSW 1 157157321 missense probably damaging 1.00
R1109:Rasal2 UTSW 1 157177638 unclassified probably benign
R1175:Rasal2 UTSW 1 157147648 missense probably damaging 1.00
R1332:Rasal2 UTSW 1 157175821 missense probably benign 0.00
R1396:Rasal2 UTSW 1 157164666 missense probably damaging 1.00
R1535:Rasal2 UTSW 1 157230059 missense probably benign 0.28
R1542:Rasal2 UTSW 1 157175851 missense possibly damaging 0.84
R1703:Rasal2 UTSW 1 157157600 missense probably damaging 1.00
R1735:Rasal2 UTSW 1 157174160 missense probably damaging 1.00
R1762:Rasal2 UTSW 1 157299144 missense possibly damaging 0.52
R2570:Rasal2 UTSW 1 157161300 missense possibly damaging 0.85
R3148:Rasal2 UTSW 1 157243764 intron probably benign
R3157:Rasal2 UTSW 1 157158655 splice site probably benign
R4277:Rasal2 UTSW 1 157157126 missense possibly damaging 0.46
R4459:Rasal2 UTSW 1 157175832 missense possibly damaging 0.46
R4460:Rasal2 UTSW 1 157175832 missense possibly damaging 0.46
R4563:Rasal2 UTSW 1 157175991 missense probably damaging 1.00
R4894:Rasal2 UTSW 1 157192804 missense probably damaging 0.97
R5147:Rasal2 UTSW 1 157175694 missense probably damaging 1.00
R5387:Rasal2 UTSW 1 157157765 missense possibly damaging 0.81
R5421:Rasal2 UTSW 1 157299141 missense probably benign 0.37
R5459:Rasal2 UTSW 1 157157661 missense probably damaging 0.99
R5651:Rasal2 UTSW 1 157157381 missense probably damaging 1.00
R5767:Rasal2 UTSW 1 157176162 missense probably damaging 1.00
R5778:Rasal2 UTSW 1 157161290 missense probably damaging 1.00
R6298:Rasal2 UTSW 1 157411862 missense possibly damaging 0.85
R6332:Rasal2 UTSW 1 157299187 missense probably damaging 1.00
R6571:Rasal2 UTSW 1 157161179 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TGAAGTGTTGTTCCCCAAAGTAC -3'
(R):5'- GGCTTTCTCTTTCAGGCTAAAGC -3'

Sequencing Primer
(F):5'- GTGTTGTTCCCCAAAGTACAAAAAG -3'
(R):5'- CTCTTTCAGGCTAAAGCTGAAC -3'
Posted On2015-10-08