Incidental Mutation 'R4672:Osbpl9'
ID348509
Institutional Source Beutler Lab
Gene Symbol Osbpl9
Ensembl Gene ENSMUSG00000028559
Gene Nameoxysterol binding protein-like 9
SynonymsORP-9, 2600011I06Rik
MMRRC Submission 041927-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.834) question?
Stock #R4672 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location109061145-109202272 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109064609 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 604 (I604T)
Ref Sequence ENSEMBL: ENSMUSP00000124742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030288] [ENSMUST00000065977] [ENSMUST00000084366] [ENSMUST00000102736] [ENSMUST00000106644] [ENSMUST00000159545] [ENSMUST00000160271] [ENSMUST00000160774] [ENSMUST00000161363] [ENSMUST00000162787] [ENSMUST00000194478]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030288
AA Change: I621T

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000030288
Gene: ENSMUSG00000028559
AA Change: I621T

DomainStartEndE-ValueType
PH 3 101 8.5e-17 SMART
low complexity region 253 274 N/A INTRINSIC
low complexity region 285 301 N/A INTRINSIC
low complexity region 349 362 N/A INTRINSIC
Pfam:Oxysterol_BP 377 729 7.3e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065977
SMART Domains Protein: ENSMUSP00000068328
Gene: ENSMUSG00000053510

DomainStartEndE-ValueType
low complexity region 139 165 N/A INTRINSIC
low complexity region 172 209 N/A INTRINSIC
Pfam:Peptidase_M16 210 348 1.1e-43 PFAM
Pfam:Peptidase_M16_C 373 559 2.3e-22 PFAM
Pfam:Peptidase_M16_C 849 1032 1.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084366
AA Change: I524T

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000081396
Gene: ENSMUSG00000028559
AA Change: I524T

DomainStartEndE-ValueType
low complexity region 156 177 N/A INTRINSIC
low complexity region 188 204 N/A INTRINSIC
low complexity region 252 265 N/A INTRINSIC
Pfam:Oxysterol_BP 277 634 7.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102736
SMART Domains Protein: ENSMUSP00000099797
Gene: ENSMUSG00000053510

DomainStartEndE-ValueType
low complexity region 139 165 N/A INTRINSIC
low complexity region 172 209 N/A INTRINSIC
Pfam:Peptidase_M16 210 348 1.4e-43 PFAM
Pfam:Peptidase_M16_C 400 515 1.1e-9 PFAM
Pfam:Peptidase_M16_C 805 988 2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106644
SMART Domains Protein: ENSMUSP00000102255
Gene: ENSMUSG00000053510

DomainStartEndE-ValueType
low complexity region 139 165 N/A INTRINSIC
coiled coil region 187 225 N/A INTRINSIC
Pfam:Peptidase_M16 281 416 1e-41 PFAM
Pfam:Peptidase_M16_C 441 627 2.2e-23 PFAM
Pfam:Peptidase_M16_M 631 913 1e-91 PFAM
Pfam:Peptidase_M16_C 917 1100 6e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125063
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139412
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150784
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150796
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159198
Predicted Effect probably benign
Transcript: ENSMUST00000159545
SMART Domains Protein: ENSMUSP00000123856
Gene: ENSMUSG00000028559

DomainStartEndE-ValueType
Blast:PH 3 54 6e-33 BLAST
SCOP:d1pls__ 4 46 9e-8 SMART
PDB:2KCJ|A 4 55 1e-10 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000160271
AA Change: I511T

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124112
Gene: ENSMUSG00000028559
AA Change: I511T

DomainStartEndE-ValueType
low complexity region 143 164 N/A INTRINSIC
low complexity region 175 191 N/A INTRINSIC
low complexity region 239 252 N/A INTRINSIC
Pfam:Oxysterol_BP 264 621 4.7e-82 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000160774
AA Change: I604T

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124742
Gene: ENSMUSG00000028559
AA Change: I604T

DomainStartEndE-ValueType
PH 3 84 6.46e-8 SMART
low complexity region 236 257 N/A INTRINSIC
low complexity region 268 284 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
Pfam:Oxysterol_BP 357 714 2.8e-82 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000161363
AA Change: I541T

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125714
Gene: ENSMUSG00000028559
AA Change: I541T

DomainStartEndE-ValueType
Blast:PH 13 34 3e-6 BLAST
low complexity region 173 194 N/A INTRINSIC
low complexity region 205 221 N/A INTRINSIC
low complexity region 269 282 N/A INTRINSIC
Pfam:Oxysterol_BP 294 651 2.2e-82 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000162787
AA Change: I608T

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124370
Gene: ENSMUSG00000028559
AA Change: I608T

DomainStartEndE-ValueType
PH 3 101 8.5e-17 SMART
low complexity region 240 261 N/A INTRINSIC
low complexity region 272 288 N/A INTRINSIC
low complexity region 336 349 N/A INTRINSIC
Pfam:Oxysterol_BP 361 718 2.8e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194478
AA Change: I631T

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000141991
Gene: ENSMUSG00000028559
AA Change: I631T

DomainStartEndE-ValueType
PH 3 101 3.7e-19 SMART
low complexity region 263 284 N/A INTRINSIC
low complexity region 295 311 N/A INTRINSIC
low complexity region 359 372 N/A INTRINSIC
Pfam:Oxysterol_BP 384 741 2e-79 PFAM
Meta Mutation Damage Score 0.216 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (113/115)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain, although some members contain only the sterol-binding domain. This family member functions as a cholesterol transfer protein that regulates Golgi structure and function. Multiple transcript variants, most of which encode distinct isoforms, have been identified. Related pseudogenes have been identified on chromosomes 3, 11 and 12. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,889,990 *330W probably null Het
Abca8a G A 11: 110,071,876 L483F possibly damaging Het
Abca8b A G 11: 109,936,448 F1507L possibly damaging Het
Adamdec1 C A 14: 68,577,904 E104* probably null Het
Adamts16 G A 13: 70,779,518 probably benign Het
AI464131 T A 4: 41,499,061 M190L probably benign Het
Alppl2 T C 1: 87,089,465 probably benign Het
Aplnr A G 2: 85,137,180 Y183C probably damaging Het
Atm G A 9: 53,522,201 R250W probably damaging Het
B4galt7 T C 13: 55,609,319 L275P probably damaging Het
C87414 T A 5: 93,636,323 R230S probably damaging Het
Ccdc178 G A 18: 22,150,444 Q10* probably null Het
Ccr9 T C 9: 123,779,687 Y145H probably damaging Het
Cd209f C T 8: 4,103,685 G188D probably damaging Het
Cep70 T A 9: 99,254,312 S23T possibly damaging Het
Cpped1 C A 16: 11,805,374 E294* probably null Het
Crisp1 T A 17: 40,294,513 probably null Het
Disp1 T C 1: 183,098,651 probably null Het
Dlg2 A T 7: 92,286,535 M624L probably damaging Het
Elf2 A G 3: 51,256,434 V558A probably damaging Het
Eno2 T C 6: 124,766,146 D209G probably damaging Het
Fam187b G A 7: 30,977,543 R159H probably damaging Het
Fh1 G A 1: 175,604,051 A423V probably benign Het
Frg1 C T 8: 41,400,809 D164N probably benign Het
Fsbp T G 4: 11,579,841 N36K probably benign Het
Gcn1l1 A G 5: 115,606,520 T1592A probably damaging Het
Gimap3 A G 6: 48,765,753 I81T probably damaging Het
Gjb6 C T 14: 57,124,778 V9I probably benign Het
Gkap1 T C 13: 58,263,956 S68G possibly damaging Het
Gm8765 T C 13: 50,703,172 Y949H probably benign Het
Gpatch8 A T 11: 102,478,958 S1251R probably damaging Het
Gria4 A G 9: 4,664,981 F92L possibly damaging Het
H2-Q1 C A 17: 35,320,930 D58E probably damaging Het
Hs1bp3 G T 12: 8,341,983 G362* probably null Het
Igfn1 T A 1: 135,965,369 H2114L possibly damaging Het
Igkv12-98 A G 6: 68,570,956 Q22R probably benign Het
Ing3 A G 6: 21,965,730 probably null Het
Insr C T 8: 3,167,501 probably null Het
Kdm3b T C 18: 34,808,577 S374P probably benign Het
Kif14 A C 1: 136,521,278 Q1472P probably benign Het
Kif14 G T 1: 136,521,279 Q1472H probably benign Het
Knstrn A G 2: 118,834,031 E202G probably damaging Het
Knstrn G T 2: 118,834,032 E202D possibly damaging Het
Krt12 A G 11: 99,418,683 probably benign Het
Lgi3 A T 14: 70,534,457 I195F possibly damaging Het
Lima1 T C 15: 99,843,709 N29D probably damaging Het
Liph T C 16: 21,984,056 I88V probably benign Het
Lrrk1 A G 7: 66,279,372 S86P probably benign Het
Lsamp A G 16: 41,955,334 R166G probably damaging Het
Mamdc2 T A 19: 23,350,784 N407Y probably damaging Het
Mast3 CATA CA 8: 70,784,797 probably null Het
Megf6 T A 4: 154,249,452 N212K probably damaging Het
Met A C 6: 17,571,804 D1374A probably benign Het
Mrc2 A G 11: 105,343,097 T902A probably benign Het
Mroh3 T A 1: 136,190,975 T535S probably benign Het
Muc1 G T 3: 89,232,077 V595L probably damaging Het
Myh2 T A 11: 67,188,477 L957Q probably damaging Het
Ncl A T 1: 86,356,602 D257E probably benign Het
Nipbl T A 15: 8,302,984 D2263V probably damaging Het
Olfr1290 A T 2: 111,489,557 N200K possibly damaging Het
Olfr727 A G 14: 50,127,257 N227D probably benign Het
Olfr855 A G 9: 19,585,430 K298E possibly damaging Het
Optc C A 1: 133,897,817 V324L possibly damaging Het
Otog C A 7: 46,289,786 A2080D probably damaging Het
Parp6 G C 9: 59,640,110 R460P probably damaging Het
Phactr4 G T 4: 132,370,706 P417Q probably damaging Het
Pigt T C 2: 164,497,578 probably benign Het
Plekha5 A G 6: 140,524,929 I99V probably damaging Het
Plxna3 T G X: 74,338,948 probably null Het
Ppp2r1b G A 9: 50,867,719 M362I probably damaging Het
Rad51 A G 2: 119,123,846 I136V probably benign Het
Rad54b T A 4: 11,609,449 H633Q probably benign Het
Rasal2 A G 1: 157,243,661 F41S probably benign Het
Reep3 T A 10: 67,021,850 H154L probably benign Het
Rp1l1 T G 14: 64,031,270 V1435G probably damaging Het
Rps6ka5 C A 12: 100,654,287 K125N possibly damaging Het
Rsad1 A T 11: 94,543,618 M330K probably damaging Het
Scand1 A G 2: 156,311,930 probably null Het
Setd6 A G 8: 95,718,012 H111R probably null Het
Slc27a3 T C 3: 90,387,646 N368S possibly damaging Het
Slc38a2 T C 15: 96,698,637 T32A probably benign Het
Smg7 A G 1: 152,845,413 S683P probably damaging Het
Smyd2 A T 1: 189,909,904 L62M probably damaging Het
Sox5 T C 6: 143,833,349 Y687C probably damaging Het
Spaca6 T A 17: 17,836,743 C53* probably null Het
Spire2 T C 8: 123,358,111 V230A probably benign Het
Sptbn2 G T 19: 4,732,496 V487L probably benign Het
Stk3 T A 15: 35,099,457 I110L probably benign Het
Stox2 T A 8: 47,192,106 Y773F probably damaging Het
Tbrg1 C A 9: 37,651,336 A259S probably damaging Het
Tnfsf18 C A 1: 161,503,738 D152E probably benign Het
Tpr G A 1: 150,423,567 A1173T probably benign Het
Trrap T C 5: 144,785,480 L271P probably damaging Het
Ttn G T 2: 76,827,075 probably benign Het
U2surp A G 9: 95,493,145 S192P possibly damaging Het
Ubr4 C T 4: 139,410,716 S1128L probably damaging Het
Ucma G A 2: 4,976,654 probably null Het
Urb1 A T 16: 90,772,634 D1401E probably benign Het
Usp54 A T 14: 20,581,529 probably benign Het
Vmn1r31 A G 6: 58,472,071 Y270H probably damaging Het
Vmn1r90 T A 7: 14,561,568 T202S probably benign Het
Vmn2r88 A G 14: 51,418,155 Y616C probably damaging Het
Vmn2r95 T A 17: 18,452,151 W717R probably damaging Het
Zcchc4 C A 5: 52,796,605 T209K probably benign Het
Zfp955b T A 17: 33,305,259 probably benign Het
Other mutations in Osbpl9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Osbpl9 APN 4 109072010 missense probably damaging 1.00
IGL00793:Osbpl9 APN 4 109087431 missense probably damaging 0.99
IGL00809:Osbpl9 APN 4 109133763 missense probably damaging 1.00
IGL02071:Osbpl9 APN 4 109071979 missense probably damaging 1.00
IGL02547:Osbpl9 APN 4 109068483 nonsense probably null
IGL02822:Osbpl9 APN 4 109072921 missense probably damaging 1.00
IGL03074:Osbpl9 APN 4 109071961 missense probably damaging 1.00
IGL03193:Osbpl9 APN 4 109066966 missense possibly damaging 0.90
IGL03196:Osbpl9 APN 4 109072864 missense probably damaging 1.00
IGL03306:Osbpl9 APN 4 109172332 splice site probably benign
IGL03323:Osbpl9 APN 4 109062459 splice site probably benign
R0211:Osbpl9 UTSW 4 109073124 missense probably damaging 1.00
R0368:Osbpl9 UTSW 4 109066932 missense probably damaging 1.00
R0620:Osbpl9 UTSW 4 109083128 missense probably damaging 1.00
R1439:Osbpl9 UTSW 4 109101156 missense probably damaging 1.00
R1711:Osbpl9 UTSW 4 109066218 missense probably damaging 1.00
R1757:Osbpl9 UTSW 4 109064583 missense probably damaging 1.00
R2237:Osbpl9 UTSW 4 109156657 missense probably damaging 1.00
R2295:Osbpl9 UTSW 4 109202134 missense probably damaging 0.99
R2418:Osbpl9 UTSW 4 109066218 missense probably damaging 1.00
R3111:Osbpl9 UTSW 4 109083093 missense probably benign 0.08
R4202:Osbpl9 UTSW 4 109172240 intron probably benign
R4706:Osbpl9 UTSW 4 109156687 missense probably damaging 1.00
R4856:Osbpl9 UTSW 4 109068367 missense probably benign 0.38
R4886:Osbpl9 UTSW 4 109068367 missense probably benign 0.38
R5035:Osbpl9 UTSW 4 109066167 missense probably damaging 0.99
R5309:Osbpl9 UTSW 4 109066155 missense probably damaging 1.00
R5400:Osbpl9 UTSW 4 109062300 nonsense probably null
R5719:Osbpl9 UTSW 4 109062566 nonsense probably null
R5810:Osbpl9 UTSW 4 109086374 missense probably benign 0.00
R6237:Osbpl9 UTSW 4 109156702 missense probably damaging 1.00
R6575:Osbpl9 UTSW 4 109072932 missense possibly damaging 0.89
R6648:Osbpl9 UTSW 4 109091679 missense possibly damaging 0.62
R6675:Osbpl9 UTSW 4 109133828 splice site probably null
R6911:Osbpl9 UTSW 4 109156373 intron probably benign
Predicted Primers PCR Primer
(F):5'- AAAGGCCATTTTGTTAGCTGTACTG -3'
(R):5'- AGATCCTCTGGAGATCCCTG -3'

Sequencing Primer
(F):5'- TAGCTGTACTGTAGGAGAGTGAG -3'
(R):5'- AGATCCCTGTCCTGAGTGAG -3'
Posted On2015-10-08