Incidental Mutation 'R4672:Sox5'
ID348526
Institutional Source Beutler Lab
Gene Symbol Sox5
Ensembl Gene ENSMUSG00000041540
Gene NameSRY (sex determining region Y)-box 5
SynonymsA730017D01Rik
MMRRC Submission 041927-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4672 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location143828425-144781977 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 143833349 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 687 (Y687C)
Ref Sequence ENSEMBL: ENSMUSP00000133041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038815] [ENSMUST00000077160] [ENSMUST00000111748] [ENSMUST00000111749] [ENSMUST00000170367]
Predicted Effect probably damaging
Transcript: ENSMUST00000038815
AA Change: Y736C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047567
Gene: ENSMUSG00000041540
AA Change: Y736C

DomainStartEndE-ValueType
low complexity region 167 178 N/A INTRINSIC
coiled coil region 193 272 N/A INTRINSIC
low complexity region 336 348 N/A INTRINSIC
low complexity region 431 445 N/A INTRINSIC
coiled coil region 449 483 N/A INTRINSIC
low complexity region 494 505 N/A INTRINSIC
HMG 555 625 2.84e-26 SMART
low complexity region 686 708 N/A INTRINSIC
low complexity region 729 750 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000077160
AA Change: Y688C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076403
Gene: ENSMUSG00000041540
AA Change: Y688C

DomainStartEndE-ValueType
low complexity region 167 178 N/A INTRINSIC
coiled coil region 193 277 N/A INTRINSIC
low complexity region 383 397 N/A INTRINSIC
coiled coil region 401 435 N/A INTRINSIC
low complexity region 446 457 N/A INTRINSIC
HMG 507 577 2.84e-26 SMART
low complexity region 638 660 N/A INTRINSIC
low complexity region 681 702 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111748
AA Change: Y365C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107377
Gene: ENSMUSG00000041540
AA Change: Y365C

DomainStartEndE-ValueType
low complexity region 60 74 N/A INTRINSIC
coiled coil region 78 112 N/A INTRINSIC
low complexity region 123 134 N/A INTRINSIC
HMG 184 254 2.84e-26 SMART
low complexity region 315 337 N/A INTRINSIC
low complexity region 358 379 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111749
AA Change: Y652C

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107378
Gene: ENSMUSG00000041540
AA Change: Y652C

DomainStartEndE-ValueType
low complexity region 132 143 N/A INTRINSIC
coiled coil region 158 237 N/A INTRINSIC
low complexity region 347 361 N/A INTRINSIC
coiled coil region 365 399 N/A INTRINSIC
low complexity region 410 421 N/A INTRINSIC
HMG 471 541 2.84e-26 SMART
low complexity region 602 624 N/A INTRINSIC
low complexity region 645 666 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170367
AA Change: Y687C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133041
Gene: ENSMUSG00000041540
AA Change: Y687C

DomainStartEndE-ValueType
low complexity region 167 178 N/A INTRINSIC
coiled coil region 193 272 N/A INTRINSIC
low complexity region 382 396 N/A INTRINSIC
coiled coil region 400 434 N/A INTRINSIC
low complexity region 445 456 N/A INTRINSIC
HMG 506 576 2.84e-26 SMART
low complexity region 637 659 N/A INTRINSIC
low complexity region 680 701 N/A INTRINSIC
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (113/115)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. The encoded protein may play a role in chondrogenesis. A pseudogene of this gene is located on chromosome 8. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice fail to breathe and die at birth exhibiting a narrow thoracic cage, irregularly mineralized sternum, cleft secondary palate, and delayed bone mineralization. Homozygotes for a transposon induced insertion die shortly after birth exhibiting cyanosis and respiratory distress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,889,990 *330W probably null Het
Abca8a G A 11: 110,071,876 L483F possibly damaging Het
Abca8b A G 11: 109,936,448 F1507L possibly damaging Het
Adamdec1 C A 14: 68,577,904 E104* probably null Het
Adamts16 G A 13: 70,779,518 probably benign Het
AI464131 T A 4: 41,499,061 M190L probably benign Het
Alppl2 T C 1: 87,089,465 probably benign Het
Aplnr A G 2: 85,137,180 Y183C probably damaging Het
Atm G A 9: 53,522,201 R250W probably damaging Het
B4galt7 T C 13: 55,609,319 L275P probably damaging Het
C87414 T A 5: 93,636,323 R230S probably damaging Het
Ccdc178 G A 18: 22,150,444 Q10* probably null Het
Ccr9 T C 9: 123,779,687 Y145H probably damaging Het
Cd209f C T 8: 4,103,685 G188D probably damaging Het
Cep70 T A 9: 99,254,312 S23T possibly damaging Het
Cpped1 C A 16: 11,805,374 E294* probably null Het
Crisp1 T A 17: 40,294,513 probably null Het
Disp1 T C 1: 183,098,651 probably null Het
Dlg2 A T 7: 92,286,535 M624L probably damaging Het
Elf2 A G 3: 51,256,434 V558A probably damaging Het
Eno2 T C 6: 124,766,146 D209G probably damaging Het
Fam187b G A 7: 30,977,543 R159H probably damaging Het
Fh1 G A 1: 175,604,051 A423V probably benign Het
Frg1 C T 8: 41,400,809 D164N probably benign Het
Fsbp T G 4: 11,579,841 N36K probably benign Het
Gcn1l1 A G 5: 115,606,520 T1592A probably damaging Het
Gimap3 A G 6: 48,765,753 I81T probably damaging Het
Gjb6 C T 14: 57,124,778 V9I probably benign Het
Gkap1 T C 13: 58,263,956 S68G possibly damaging Het
Gm8765 T C 13: 50,703,172 Y949H probably benign Het
Gpatch8 A T 11: 102,478,958 S1251R probably damaging Het
Gria4 A G 9: 4,664,981 F92L possibly damaging Het
H2-Q1 C A 17: 35,320,930 D58E probably damaging Het
Hs1bp3 G T 12: 8,341,983 G362* probably null Het
Igfn1 T A 1: 135,965,369 H2114L possibly damaging Het
Igkv12-98 A G 6: 68,570,956 Q22R probably benign Het
Ing3 A G 6: 21,965,730 probably null Het
Insr C T 8: 3,167,501 probably null Het
Kdm3b T C 18: 34,808,577 S374P probably benign Het
Kif14 A C 1: 136,521,278 Q1472P probably benign Het
Kif14 G T 1: 136,521,279 Q1472H probably benign Het
Knstrn A G 2: 118,834,031 E202G probably damaging Het
Knstrn G T 2: 118,834,032 E202D possibly damaging Het
Krt12 A G 11: 99,418,683 probably benign Het
Lgi3 A T 14: 70,534,457 I195F possibly damaging Het
Lima1 T C 15: 99,843,709 N29D probably damaging Het
Liph T C 16: 21,984,056 I88V probably benign Het
Lrrk1 A G 7: 66,279,372 S86P probably benign Het
Lsamp A G 16: 41,955,334 R166G probably damaging Het
Mamdc2 T A 19: 23,350,784 N407Y probably damaging Het
Mast3 CATA CA 8: 70,784,797 probably null Het
Megf6 T A 4: 154,249,452 N212K probably damaging Het
Met A C 6: 17,571,804 D1374A probably benign Het
Mrc2 A G 11: 105,343,097 T902A probably benign Het
Mroh3 T A 1: 136,190,975 T535S probably benign Het
Muc1 G T 3: 89,232,077 V595L probably damaging Het
Myh2 T A 11: 67,188,477 L957Q probably damaging Het
Ncl A T 1: 86,356,602 D257E probably benign Het
Nipbl T A 15: 8,302,984 D2263V probably damaging Het
Olfr1290 A T 2: 111,489,557 N200K possibly damaging Het
Olfr727 A G 14: 50,127,257 N227D probably benign Het
Olfr855 A G 9: 19,585,430 K298E possibly damaging Het
Optc C A 1: 133,897,817 V324L possibly damaging Het
Osbpl9 A G 4: 109,064,609 I604T possibly damaging Het
Otog C A 7: 46,289,786 A2080D probably damaging Het
Parp6 G C 9: 59,640,110 R460P probably damaging Het
Phactr4 G T 4: 132,370,706 P417Q probably damaging Het
Pigt T C 2: 164,497,578 probably benign Het
Plekha5 A G 6: 140,524,929 I99V probably damaging Het
Plxna3 T G X: 74,338,948 probably null Het
Ppp2r1b G A 9: 50,867,719 M362I probably damaging Het
Rad51 A G 2: 119,123,846 I136V probably benign Het
Rad54b T A 4: 11,609,449 H633Q probably benign Het
Rasal2 A G 1: 157,243,661 F41S probably benign Het
Reep3 T A 10: 67,021,850 H154L probably benign Het
Rp1l1 T G 14: 64,031,270 V1435G probably damaging Het
Rps6ka5 C A 12: 100,654,287 K125N possibly damaging Het
Rsad1 A T 11: 94,543,618 M330K probably damaging Het
Scand1 A G 2: 156,311,930 probably null Het
Setd6 A G 8: 95,718,012 H111R probably null Het
Slc27a3 T C 3: 90,387,646 N368S possibly damaging Het
Slc38a2 T C 15: 96,698,637 T32A probably benign Het
Smg7 A G 1: 152,845,413 S683P probably damaging Het
Smyd2 A T 1: 189,909,904 L62M probably damaging Het
Spaca6 T A 17: 17,836,743 C53* probably null Het
Spire2 T C 8: 123,358,111 V230A probably benign Het
Sptbn2 G T 19: 4,732,496 V487L probably benign Het
Stk3 T A 15: 35,099,457 I110L probably benign Het
Stox2 T A 8: 47,192,106 Y773F probably damaging Het
Tbrg1 C A 9: 37,651,336 A259S probably damaging Het
Tnfsf18 C A 1: 161,503,738 D152E probably benign Het
Tpr G A 1: 150,423,567 A1173T probably benign Het
Trrap T C 5: 144,785,480 L271P probably damaging Het
Ttn G T 2: 76,827,075 probably benign Het
U2surp A G 9: 95,493,145 S192P possibly damaging Het
Ubr4 C T 4: 139,410,716 S1128L probably damaging Het
Ucma G A 2: 4,976,654 probably null Het
Urb1 A T 16: 90,772,634 D1401E probably benign Het
Usp54 A T 14: 20,581,529 probably benign Het
Vmn1r31 A G 6: 58,472,071 Y270H probably damaging Het
Vmn1r90 T A 7: 14,561,568 T202S probably benign Het
Vmn2r88 A G 14: 51,418,155 Y616C probably damaging Het
Vmn2r95 T A 17: 18,452,151 W717R probably damaging Het
Zcchc4 C A 5: 52,796,605 T209K probably benign Het
Zfp955b T A 17: 33,305,259 probably benign Het
Other mutations in Sox5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Sox5 APN 6 144116472 missense probably damaging 0.96
IGL03217:Sox5 APN 6 143907497 missense probably damaging 1.00
R0230:Sox5 UTSW 6 144209338 missense probably benign 0.02
R0610:Sox5 UTSW 6 143833439 missense possibly damaging 0.56
R1162:Sox5 UTSW 6 143960812 missense probably damaging 1.00
R1857:Sox5 UTSW 6 143960815 missense probably damaging 1.00
R1959:Sox5 UTSW 6 143874105 missense possibly damaging 0.94
R4057:Sox5 UTSW 6 144116522 missense probably damaging 1.00
R4164:Sox5 UTSW 6 144116480 missense probably damaging 1.00
R4284:Sox5 UTSW 6 143835329 missense probably damaging 1.00
R4430:Sox5 UTSW 6 144041274 missense possibly damaging 0.57
R4470:Sox5 UTSW 6 143844765 missense possibly damaging 0.54
R4471:Sox5 UTSW 6 143844765 missense possibly damaging 0.54
R4683:Sox5 UTSW 6 143833467 missense probably damaging 0.99
R4693:Sox5 UTSW 6 143835316 missense probably damaging 1.00
R4735:Sox5 UTSW 6 143960835 missense probably damaging 1.00
R4745:Sox5 UTSW 6 143833488 missense possibly damaging 0.53
R4762:Sox5 UTSW 6 143861383 critical splice donor site probably null
R4996:Sox5 UTSW 6 144028344 nonsense probably null
R5218:Sox5 UTSW 6 143960890 missense possibly damaging 0.93
R5673:Sox5 UTSW 6 144116480 missense probably damaging 1.00
R5856:Sox5 UTSW 6 144209362 missense probably damaging 1.00
R6249:Sox5 UTSW 6 143833283 missense probably benign 0.33
R6394:Sox5 UTSW 6 144041313 missense probably damaging 1.00
R6703:Sox5 UTSW 6 143833465 missense probably damaging 1.00
R6812:Sox5 UTSW 6 144116443 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TAATGTGCTTGGCCACTGG -3'
(R):5'- TCTCTTTCTGTGACAGGCAAC -3'

Sequencing Primer
(F):5'- CTTGGCCACTGGGAAGGATG -3'
(R):5'- AGTTGTATACCCCAGCGCC -3'
Posted On2015-10-08