Mutagenetix > Incidental Mutations

Incidental Mutation 'R4672:Gria4'

348538

Institutional Source

Beutler Lab

Gene Symbol

Gria4

Ensembl Gene

ENSMUSG00000025892

Gene Name

glutamate receptor, ionotropic, AMPA4 (alpha 4)

Synonyms

Gluralpha4, spkw1, Glur4, Glur-4

MMRRC Submission

041927-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.366) question?

Stock #

R4672 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

4417896-4796234 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 4664981 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 92 (F92L)

Ref Sequence

ENSEMBL: ENSMUSP00000129316 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027020] [ENSMUST00000063508] [ENSMUST00000163309] [ENSMUST00000212533]

Predicted Effect

probably benign
Transcript: ENSMUST00000027020
AA Change: F92L

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000027020
Gene: ENSMUSG00000025892
AA Change: F92L

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	3e-61	PFAM
PBPe	416	791	8.23e-129	SMART
Lig_chan-Glu_bd	426	491	3.4e-31	SMART
low complexity region	821	833	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000063508
AA Change: F92L

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000066980
Gene: ENSMUSG00000025892
AA Change: F92L

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	2.5e-71	PFAM
PBPe	416	791	2.06e-129	SMART
Lig_chan-Glu_bd	426	491	3.4e-31	SMART
low complexity region	821	833	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163309
AA Change: F92L

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000129316
Gene: ENSMUSG00000025892
AA Change: F92L

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	3.2e-62	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000212533
AA Change: F92L

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)

Meta Mutation Damage Score

0.05

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

98% (113/115)

MGI Phenotype

FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing of this gene results in transcript variants encoding different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display hyperactivity, decreased thermal nociception, and abnormal sensitivity to pharmacologically induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	A	G	3: 36,889,990	*330W	probably null	Het
Abca8a	G	A	11: 110,071,876	L483F	possibly damaging	Het
Abca8b	A	G	11: 109,936,448	F1507L	possibly damaging	Het
Adamdec1	C	A	14: 68,577,904	E104*	probably null	Het
Adamts16	G	A	13: 70,779,518		probably benign	Het
AI464131	T	A	4: 41,499,061	M190L	probably benign	Het
Alppl2	T	C	1: 87,089,465		probably benign	Het
Aplnr	A	G	2: 85,137,180	Y183C	probably damaging	Het
Atm	G	A	9: 53,522,201	R250W	probably damaging	Het
B4galt7	T	C	13: 55,609,319	L275P	probably damaging	Het
C87414	T	A	5: 93,636,323	R230S	probably damaging	Het
Ccdc178	G	A	18: 22,150,444	Q10*	probably null	Het
Ccr9	T	C	9: 123,779,687	Y145H	probably damaging	Het
Cd209f	C	T	8: 4,103,685	G188D	probably damaging	Het
Cep70	T	A	9: 99,254,312	S23T	possibly damaging	Het
Cpped1	C	A	16: 11,805,374	E294*	probably null	Het
Crisp1	T	A	17: 40,294,513		probably null	Het
Disp1	T	C	1: 183,098,651		probably null	Het
Dlg2	A	T	7: 92,286,535	M624L	probably damaging	Het
Elf2	A	G	3: 51,256,434	V558A	probably damaging	Het
Eno2	T	C	6: 124,766,146	D209G	probably damaging	Het
Fam187b	G	A	7: 30,977,543	R159H	probably damaging	Het
Fh1	G	A	1: 175,604,051	A423V	probably benign	Het
Frg1	C	T	8: 41,400,809	D164N	probably benign	Het
Fsbp	T	G	4: 11,579,841	N36K	probably benign	Het
Gcn1l1	A	G	5: 115,606,520	T1592A	probably damaging	Het
Gimap3	A	G	6: 48,765,753	I81T	probably damaging	Het
Gjb6	C	T	14: 57,124,778	V9I	probably benign	Het
Gkap1	T	C	13: 58,263,956	S68G	possibly damaging	Het
Gm8765	T	C	13: 50,703,172	Y949H	probably benign	Het
Gpatch8	A	T	11: 102,478,958	S1251R	probably damaging	Het
H2-Q1	C	A	17: 35,320,930	D58E	probably damaging	Het
Hs1bp3	G	T	12: 8,341,983	G362*	probably null	Het
Igfn1	T	A	1: 135,965,369	H2114L	possibly damaging	Het
Igkv12-98	A	G	6: 68,570,956	Q22R	probably benign	Het
Ing3	A	G	6: 21,965,730		probably null	Het
Insr	C	T	8: 3,167,501		probably null	Het
Kdm3b	T	C	18: 34,808,577	S374P	probably benign	Het
Kif14	A	C	1: 136,521,278	Q1472P	probably benign	Het
Kif14	G	T	1: 136,521,279	Q1472H	probably benign	Het
Knstrn	A	G	2: 118,834,031	E202G	probably damaging	Het
Knstrn	G	T	2: 118,834,032	E202D	possibly damaging	Het
Krt12	A	G	11: 99,418,683		probably benign	Het
Lgi3	A	T	14: 70,534,457	I195F	possibly damaging	Het
Lima1	T	C	15: 99,843,709	N29D	probably damaging	Het
Liph	T	C	16: 21,984,056	I88V	probably benign	Het
Lrrk1	A	G	7: 66,279,372	S86P	probably benign	Het
Lsamp	A	G	16: 41,955,334	R166G	probably damaging	Het
Mamdc2	T	A	19: 23,350,784	N407Y	probably damaging	Het
Mast3	CATA	CA	8: 70,784,797		probably null	Het
Megf6	T	A	4: 154,249,452	N212K	probably damaging	Het
Met	A	C	6: 17,571,804	D1374A	probably benign	Het
Mrc2	A	G	11: 105,343,097	T902A	probably benign	Het
Mroh3	T	A	1: 136,190,975	T535S	probably benign	Het
Muc1	G	T	3: 89,232,077	V595L	probably damaging	Het
Myh2	T	A	11: 67,188,477	L957Q	probably damaging	Het
Ncl	A	T	1: 86,356,602	D257E	probably benign	Het
Nipbl	T	A	15: 8,302,984	D2263V	probably damaging	Het
Olfr1290	A	T	2: 111,489,557	N200K	possibly damaging	Het
Olfr727	A	G	14: 50,127,257	N227D	probably benign	Het
Olfr855	A	G	9: 19,585,430	K298E	possibly damaging	Het
Optc	C	A	1: 133,897,817	V324L	possibly damaging	Het
Osbpl9	A	G	4: 109,064,609	I604T	possibly damaging	Het
Otog	C	A	7: 46,289,786	A2080D	probably damaging	Het
Parp6	G	C	9: 59,640,110	R460P	probably damaging	Het
Phactr4	G	T	4: 132,370,706	P417Q	probably damaging	Het
Pigt	T	C	2: 164,497,578		probably benign	Het
Plekha5	A	G	6: 140,524,929	I99V	probably damaging	Het
Plxna3	T	G	X: 74,338,948		probably null	Het
Ppp2r1b	G	A	9: 50,867,719	M362I	probably damaging	Het
Rad51	A	G	2: 119,123,846	I136V	probably benign	Het
Rad54b	T	A	4: 11,609,449	H633Q	probably benign	Het
Rasal2	A	G	1: 157,243,661	F41S	probably benign	Het
Reep3	T	A	10: 67,021,850	H154L	probably benign	Het
Rp1l1	T	G	14: 64,031,270	V1435G	probably damaging	Het
Rps6ka5	C	A	12: 100,654,287	K125N	possibly damaging	Het
Rsad1	A	T	11: 94,543,618	M330K	probably damaging	Het
Scand1	A	G	2: 156,311,930		probably null	Het
Setd6	A	G	8: 95,718,012	H111R	probably null	Het
Slc27a3	T	C	3: 90,387,646	N368S	possibly damaging	Het
Slc38a2	T	C	15: 96,698,637	T32A	probably benign	Het
Smg7	A	G	1: 152,845,413	S683P	probably damaging	Het
Smyd2	A	T	1: 189,909,904	L62M	probably damaging	Het
Sox5	T	C	6: 143,833,349	Y687C	probably damaging	Het
Spaca6	T	A	17: 17,836,743	C53*	probably null	Het
Spire2	T	C	8: 123,358,111	V230A	probably benign	Het
Sptbn2	G	T	19: 4,732,496	V487L	probably benign	Het
Stk3	T	A	15: 35,099,457	I110L	probably benign	Het
Stox2	T	A	8: 47,192,106	Y773F	probably damaging	Het
Tbrg1	C	A	9: 37,651,336	A259S	probably damaging	Het
Tnfsf18	C	A	1: 161,503,738	D152E	probably benign	Het
Tpr	G	A	1: 150,423,567	A1173T	probably benign	Het
Trrap	T	C	5: 144,785,480	L271P	probably damaging	Het
Ttn	G	T	2: 76,827,075		probably benign	Het
U2surp	A	G	9: 95,493,145	S192P	possibly damaging	Het
Ubr4	C	T	4: 139,410,716	S1128L	probably damaging	Het
Ucma	G	A	2: 4,976,654		probably null	Het
Urb1	A	T	16: 90,772,634	D1401E	probably benign	Het
Usp54	A	T	14: 20,581,529		probably benign	Het
Vmn1r31	A	G	6: 58,472,071	Y270H	probably damaging	Het
Vmn1r90	T	A	7: 14,561,568	T202S	probably benign	Het
Vmn2r88	A	G	14: 51,418,155	Y616C	probably damaging	Het
Vmn2r95	T	A	17: 18,452,151	W717R	probably damaging	Het
Zcchc4	C	A	5: 52,796,605	T209K	probably benign	Het
Zfp955b	T	A	17: 33,305,259		probably benign	Het

Other mutations in Gria4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00814:Gria4	APN	9	4472202	missense	probably damaging	0.98
IGL01451:Gria4	APN	9	4503652	missense	probably benign	0.04
IGL01533:Gria4	APN	9	4502395	missense	probably damaging	1.00
IGL01994:Gria4	APN	9	4537726	missense	probably damaging	1.00
IGL02078:Gria4	APN	9	4793878	missense	probably damaging	0.98
IGL02183:Gria4	APN	9	4502460	missense	probably damaging	1.00
IGL02351:Gria4	APN	9	4456206	missense	possibly damaging	0.84
IGL02358:Gria4	APN	9	4456206	missense	possibly damaging	0.84
IGL03118:Gria4	APN	9	4793804	splice site	probably benign
IGL03131:Gria4	APN	9	4432876	missense	probably damaging	0.96
IGL03148:Gria4	APN	9	4464295	missense	possibly damaging	0.91
IGL03264:Gria4	APN	9	4513288	missense	probably benign
R0018:Gria4	UTSW	9	4432843	missense	possibly damaging	0.71
R0295:Gria4	UTSW	9	4793840	missense	possibly damaging	0.69
R0654:Gria4	UTSW	9	4464372	missense	probably benign	0.32
R0690:Gria4	UTSW	9	4427071	missense	probably damaging	1.00
R0992:Gria4	UTSW	9	4795238	missense	probably benign
R1517:Gria4	UTSW	9	4793865	missense	probably damaging	1.00
R1673:Gria4	UTSW	9	4537637	nonsense	probably null
R1713:Gria4	UTSW	9	4424448	missense	probably benign	0.20
R1961:Gria4	UTSW	9	4519546	splice site	probably benign
R2137:Gria4	UTSW	9	4427026	intron	probably benign
R2397:Gria4	UTSW	9	4537717	missense	probably damaging	1.00
R2870:Gria4	UTSW	9	4503614	missense	probably damaging	0.96
R2870:Gria4	UTSW	9	4503614	missense	probably damaging	0.96
R3014:Gria4	UTSW	9	4464294	missense	probably damaging	0.97
R3412:Gria4	UTSW	9	4513278	missense	probably benign	0.00
R3732:Gria4	UTSW	9	4513295	missense	probably benign
R3732:Gria4	UTSW	9	4513295	missense	probably benign
R3733:Gria4	UTSW	9	4513295	missense	probably benign
R3897:Gria4	UTSW	9	4513260	missense	probably damaging	1.00
R4404:Gria4	UTSW	9	4464489	splice site	probably null
R4457:Gria4	UTSW	9	4427074	missense	probably damaging	1.00
R4865:Gria4	UTSW	9	4464295	missense	possibly damaging	0.91
R5092:Gria4	UTSW	9	4472176	missense	probably benign	0.01
R5109:Gria4	UTSW	9	4472168	missense	probably damaging	1.00
R5202:Gria4	UTSW	9	4424330	missense	probably benign	0.10
R5828:Gria4	UTSW	9	4432832	missense	probably damaging	1.00
R5945:Gria4	UTSW	9	4456122	missense	probably damaging	1.00
R5985:Gria4	UTSW	9	4503593	missense	probably damaging	0.99
R6036:Gria4	UTSW	9	4537646	missense	probably benign	0.00
R6036:Gria4	UTSW	9	4537646	missense	probably benign	0.00
R6111:Gria4	UTSW	9	4502430	missense	probably damaging	1.00
R6190:Gria4	UTSW	9	4420199	missense	probably benign
R6280:Gria4	UTSW	9	4456072	missense	probably damaging	1.00
R6406:Gria4	UTSW	9	4427077	missense	probably damaging	1.00
R6470:Gria4	UTSW	9	4503680	missense	probably damaging	1.00
R6485:Gria4	UTSW	9	4464249	missense	probably damaging	1.00
R6612:Gria4	UTSW	9	4472206	missense	possibly damaging	0.93
R6848:Gria4	UTSW	9	4793822	missense	probably damaging	1.00
X0023:Gria4	UTSW	9	4427067	missense	probably damaging	1.00
X0065:Gria4	UTSW	9	4464340	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- ATAGTGATCCAGGAGGCTCAGG -3'
(R):5'- CTTTAATTGAAGCTTGGCTGTCAGC -3'

Sequencing Primer
(F):5'- GAGTGCACCTCTCAATGAAGGTC -3'
(R):5'- GCAGTTTCACAATGGGGT -3'

Posted On

2015-10-08