Incidental Mutation 'R4672:Abca8b'
ID348555
Institutional Source Beutler Lab
Gene Symbol Abca8b
Ensembl Gene ENSMUSG00000020620
Gene NameATP-binding cassette, sub-family A (ABC1), member 8b
SynonymsAbca8
MMRRC Submission 041927-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock #R4672 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location109932190-109995845 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109936448 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1507 (F1507L)
Ref Sequence ENSEMBL: ENSMUSP00000020948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020948] [ENSMUST00000106669]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020948
AA Change: F1507L

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020948
Gene: ENSMUSG00000020620
AA Change: F1507L

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 417 3.9e-28 PFAM
AAA 507 691 6.36e-10 SMART
Pfam:ABC2_membrane_3 859 1215 1e-10 PFAM
low complexity region 1246 1255 N/A INTRINSIC
AAA 1313 1492 6.17e-8 SMART
low complexity region 1597 1607 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106669
AA Change: F1445L

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102280
Gene: ENSMUSG00000020620
AA Change: F1445L

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 344 2.6e-16 PFAM
AAA 445 629 6.36e-10 SMART
transmembrane domain 798 815 N/A INTRINSIC
transmembrane domain 1001 1023 N/A INTRINSIC
transmembrane domain 1038 1060 N/A INTRINSIC
transmembrane domain 1072 1091 N/A INTRINSIC
transmembrane domain 1101 1123 N/A INTRINSIC
transmembrane domain 1136 1158 N/A INTRINSIC
low complexity region 1184 1193 N/A INTRINSIC
AAA 1251 1430 6.17e-8 SMART
low complexity region 1535 1545 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149226
Meta Mutation Damage Score 0.098 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (113/115)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The encoded protein may regulate lipid metabolism and be involved in the formation and maintenance of myelin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,889,990 *330W probably null Het
Abca8a G A 11: 110,071,876 L483F possibly damaging Het
Adamdec1 C A 14: 68,577,904 E104* probably null Het
Adamts16 G A 13: 70,779,518 probably benign Het
AI464131 T A 4: 41,499,061 M190L probably benign Het
Alppl2 T C 1: 87,089,465 probably benign Het
Aplnr A G 2: 85,137,180 Y183C probably damaging Het
Atm G A 9: 53,522,201 R250W probably damaging Het
B4galt7 T C 13: 55,609,319 L275P probably damaging Het
C87414 T A 5: 93,636,323 R230S probably damaging Het
Ccdc178 G A 18: 22,150,444 Q10* probably null Het
Ccr9 T C 9: 123,779,687 Y145H probably damaging Het
Cd209f C T 8: 4,103,685 G188D probably damaging Het
Cep70 T A 9: 99,254,312 S23T possibly damaging Het
Cpped1 C A 16: 11,805,374 E294* probably null Het
Crisp1 T A 17: 40,294,513 probably null Het
Disp1 T C 1: 183,098,651 probably null Het
Dlg2 A T 7: 92,286,535 M624L probably damaging Het
Elf2 A G 3: 51,256,434 V558A probably damaging Het
Eno2 T C 6: 124,766,146 D209G probably damaging Het
Fam187b G A 7: 30,977,543 R159H probably damaging Het
Fh1 G A 1: 175,604,051 A423V probably benign Het
Frg1 C T 8: 41,400,809 D164N probably benign Het
Fsbp T G 4: 11,579,841 N36K probably benign Het
Gcn1l1 A G 5: 115,606,520 T1592A probably damaging Het
Gimap3 A G 6: 48,765,753 I81T probably damaging Het
Gjb6 C T 14: 57,124,778 V9I probably benign Het
Gkap1 T C 13: 58,263,956 S68G possibly damaging Het
Gm8765 T C 13: 50,703,172 Y949H probably benign Het
Gpatch8 A T 11: 102,478,958 S1251R probably damaging Het
Gria4 A G 9: 4,664,981 F92L possibly damaging Het
H2-Q1 C A 17: 35,320,930 D58E probably damaging Het
Hs1bp3 G T 12: 8,341,983 G362* probably null Het
Igfn1 T A 1: 135,965,369 H2114L possibly damaging Het
Igkv12-98 A G 6: 68,570,956 Q22R probably benign Het
Ing3 A G 6: 21,965,730 probably null Het
Insr C T 8: 3,167,501 probably null Het
Kdm3b T C 18: 34,808,577 S374P probably benign Het
Kif14 A C 1: 136,521,278 Q1472P probably benign Het
Kif14 G T 1: 136,521,279 Q1472H probably benign Het
Knstrn A G 2: 118,834,031 E202G probably damaging Het
Knstrn G T 2: 118,834,032 E202D possibly damaging Het
Krt12 A G 11: 99,418,683 probably benign Het
Lgi3 A T 14: 70,534,457 I195F possibly damaging Het
Lima1 T C 15: 99,843,709 N29D probably damaging Het
Liph T C 16: 21,984,056 I88V probably benign Het
Lrrk1 A G 7: 66,279,372 S86P probably benign Het
Lsamp A G 16: 41,955,334 R166G probably damaging Het
Mamdc2 T A 19: 23,350,784 N407Y probably damaging Het
Mast3 CATA CA 8: 70,784,797 probably null Het
Megf6 T A 4: 154,249,452 N212K probably damaging Het
Met A C 6: 17,571,804 D1374A probably benign Het
Mrc2 A G 11: 105,343,097 T902A probably benign Het
Mroh3 T A 1: 136,190,975 T535S probably benign Het
Muc1 G T 3: 89,232,077 V595L probably damaging Het
Myh2 T A 11: 67,188,477 L957Q probably damaging Het
Ncl A T 1: 86,356,602 D257E probably benign Het
Nipbl T A 15: 8,302,984 D2263V probably damaging Het
Olfr1290 A T 2: 111,489,557 N200K possibly damaging Het
Olfr727 A G 14: 50,127,257 N227D probably benign Het
Olfr855 A G 9: 19,585,430 K298E possibly damaging Het
Optc C A 1: 133,897,817 V324L possibly damaging Het
Osbpl9 A G 4: 109,064,609 I604T possibly damaging Het
Otog C A 7: 46,289,786 A2080D probably damaging Het
Parp6 G C 9: 59,640,110 R460P probably damaging Het
Phactr4 G T 4: 132,370,706 P417Q probably damaging Het
Pigt T C 2: 164,497,578 probably benign Het
Plekha5 A G 6: 140,524,929 I99V probably damaging Het
Plxna3 T G X: 74,338,948 probably null Het
Ppp2r1b G A 9: 50,867,719 M362I probably damaging Het
Rad51 A G 2: 119,123,846 I136V probably benign Het
Rad54b T A 4: 11,609,449 H633Q probably benign Het
Rasal2 A G 1: 157,243,661 F41S probably benign Het
Reep3 T A 10: 67,021,850 H154L probably benign Het
Rp1l1 T G 14: 64,031,270 V1435G probably damaging Het
Rps6ka5 C A 12: 100,654,287 K125N possibly damaging Het
Rsad1 A T 11: 94,543,618 M330K probably damaging Het
Scand1 A G 2: 156,311,930 probably null Het
Setd6 A G 8: 95,718,012 H111R probably null Het
Slc27a3 T C 3: 90,387,646 N368S possibly damaging Het
Slc38a2 T C 15: 96,698,637 T32A probably benign Het
Smg7 A G 1: 152,845,413 S683P probably damaging Het
Smyd2 A T 1: 189,909,904 L62M probably damaging Het
Sox5 T C 6: 143,833,349 Y687C probably damaging Het
Spaca6 T A 17: 17,836,743 C53* probably null Het
Spire2 T C 8: 123,358,111 V230A probably benign Het
Sptbn2 G T 19: 4,732,496 V487L probably benign Het
Stk3 T A 15: 35,099,457 I110L probably benign Het
Stox2 T A 8: 47,192,106 Y773F probably damaging Het
Tbrg1 C A 9: 37,651,336 A259S probably damaging Het
Tnfsf18 C A 1: 161,503,738 D152E probably benign Het
Tpr G A 1: 150,423,567 A1173T probably benign Het
Trrap T C 5: 144,785,480 L271P probably damaging Het
Ttn G T 2: 76,827,075 probably benign Het
U2surp A G 9: 95,493,145 S192P possibly damaging Het
Ubr4 C T 4: 139,410,716 S1128L probably damaging Het
Ucma G A 2: 4,976,654 probably null Het
Urb1 A T 16: 90,772,634 D1401E probably benign Het
Usp54 A T 14: 20,581,529 probably benign Het
Vmn1r31 A G 6: 58,472,071 Y270H probably damaging Het
Vmn1r90 T A 7: 14,561,568 T202S probably benign Het
Vmn2r88 A G 14: 51,418,155 Y616C probably damaging Het
Vmn2r95 T A 17: 18,452,151 W717R probably damaging Het
Zcchc4 C A 5: 52,796,605 T209K probably benign Het
Zfp955b T A 17: 33,305,259 probably benign Het
Other mutations in Abca8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00862:Abca8b APN 11 109953548 missense possibly damaging 0.66
IGL00952:Abca8b APN 11 109969060 critical splice donor site probably null
IGL01141:Abca8b APN 11 109937730 missense probably damaging 1.00
IGL01523:Abca8b APN 11 109976494 missense probably damaging 1.00
IGL01633:Abca8b APN 11 109936754 missense probably damaging 0.99
IGL01862:Abca8b APN 11 109947171 nonsense probably null
IGL01963:Abca8b APN 11 109971763 missense probably damaging 0.99
IGL02169:Abca8b APN 11 109952582 missense probably damaging 0.98
IGL02536:Abca8b APN 11 109981748 missense probably benign 0.02
IGL02658:Abca8b APN 11 109952560 missense probably benign
IGL02828:Abca8b APN 11 109980894 missense probably damaging 0.99
IGL03118:Abca8b APN 11 109947181 missense possibly damaging 0.66
IGL03302:Abca8b APN 11 109967750 missense possibly damaging 0.80
IGL03325:Abca8b APN 11 109953596 missense possibly damaging 0.94
R0057:Abca8b UTSW 11 109941559 missense possibly damaging 0.91
R0131:Abca8b UTSW 11 109942289 missense possibly damaging 0.46
R0226:Abca8b UTSW 11 109957018 intron probably null
R0426:Abca8b UTSW 11 109955027 splice site probably benign
R0432:Abca8b UTSW 11 109980015 missense possibly damaging 0.94
R0512:Abca8b UTSW 11 109950650 missense probably benign 0.32
R0589:Abca8b UTSW 11 109942268 missense probably damaging 0.96
R0690:Abca8b UTSW 11 109969808 splice site probably benign
R1263:Abca8b UTSW 11 109941607 missense possibly damaging 0.66
R1371:Abca8b UTSW 11 109953553 missense probably damaging 0.99
R1497:Abca8b UTSW 11 109973821 splice site probably benign
R1502:Abca8b UTSW 11 109974645 missense probably damaging 1.00
R1517:Abca8b UTSW 11 109971814 missense possibly damaging 0.66
R1543:Abca8b UTSW 11 109974674 missense probably damaging 0.98
R1618:Abca8b UTSW 11 109949888 splice site probably benign
R1625:Abca8b UTSW 11 109967121 missense probably benign 0.11
R1753:Abca8b UTSW 11 109973716 missense probably benign 0.00
R1819:Abca8b UTSW 11 109981056 critical splice acceptor site probably null
R1822:Abca8b UTSW 11 109957075 missense possibly damaging 0.92
R1829:Abca8b UTSW 11 109942341 missense probably damaging 0.97
R1873:Abca8b UTSW 11 109979955 missense probably benign 0.01
R1899:Abca8b UTSW 11 109937918 missense possibly damaging 0.92
R1908:Abca8b UTSW 11 109957098 missense possibly damaging 0.92
R1962:Abca8b UTSW 11 109979898 missense probably benign 0.00
R1984:Abca8b UTSW 11 109977841 missense probably damaging 1.00
R2035:Abca8b UTSW 11 109957106 missense possibly damaging 0.94
R2092:Abca8b UTSW 11 109966708 missense possibly damaging 0.63
R2100:Abca8b UTSW 11 109937782 missense probably damaging 1.00
R2267:Abca8b UTSW 11 109955148 missense probably benign 0.03
R2871:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2871:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2872:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2872:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2873:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R3711:Abca8b UTSW 11 109946255 missense possibly damaging 0.46
R3937:Abca8b UTSW 11 109974567 missense probably benign 0.01
R4052:Abca8b UTSW 11 109981725 nonsense probably null
R4060:Abca8b UTSW 11 109957201 missense probably benign 0.04
R4207:Abca8b UTSW 11 109981725 nonsense probably null
R4208:Abca8b UTSW 11 109981725 nonsense probably null
R4354:Abca8b UTSW 11 109971692 missense probably benign 0.27
R4399:Abca8b UTSW 11 109936385 missense possibly damaging 0.66
R4456:Abca8b UTSW 11 109942245 missense probably benign 0.27
R4509:Abca8b UTSW 11 109966755 missense probably damaging 1.00
R4868:Abca8b UTSW 11 109974512 missense probably benign 0.05
R5002:Abca8b UTSW 11 109961797 missense probably damaging 0.96
R5007:Abca8b UTSW 11 109936764 missense probably damaging 1.00
R5014:Abca8b UTSW 11 109950131 missense probably damaging 0.98
R5023:Abca8b UTSW 11 109974988 critical splice donor site probably null
R5091:Abca8b UTSW 11 109936384 missense possibly damaging 0.92
R5098:Abca8b UTSW 11 109957118 missense probably benign 0.05
R5117:Abca8b UTSW 11 109966803 missense probably damaging 1.00
R5234:Abca8b UTSW 11 109976594 missense possibly damaging 0.90
R5302:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5307:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5487:Abca8b UTSW 11 109953514 missense probably damaging 0.99
R5512:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5564:Abca8b UTSW 11 109934581 missense probably benign 0.08
R5610:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5677:Abca8b UTSW 11 109940861 missense probably damaging 1.00
R5723:Abca8b UTSW 11 109953619 missense possibly damaging 0.90
R5827:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5829:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5848:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5849:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5850:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5854:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5982:Abca8b UTSW 11 109953597 missense possibly damaging 0.80
R5994:Abca8b UTSW 11 109949766 splice site probably null
R6035:Abca8b UTSW 11 109971860 splice site probably null
R6035:Abca8b UTSW 11 109971860 splice site probably null
R6050:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R6145:Abca8b UTSW 11 109973808 missense probably benign 0.03
R6223:Abca8b UTSW 11 109977846 missense probably benign 0.00
R6349:Abca8b UTSW 11 109934718 splice site probably null
Z1088:Abca8b UTSW 11 109976482 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TTCCTTTCAACTGACTACAAACCAG -3'
(R):5'- CCACACTGACTCTTGCAATGTG -3'

Sequencing Primer
(F):5'- CAACTGACTACAAACCAGTATAACTG -3'
(R):5'- CTAGATGGTGTTTCCCATAGACAAGG -3'
Posted On2015-10-08