Incidental Mutation 'R4673:Ogg1'
ID348614
Institutional Source Beutler Lab
Gene Symbol Ogg1
Ensembl Gene ENSMUSG00000030271
Gene Name8-oxoguanine DNA-glycosylase 1
SynonymsMmh
MMRRC Submission 041928-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock #R4673 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location113326972-113335068 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113327307 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 28 (C28R)
Ref Sequence ENSEMBL: ENSMUSP00000144905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032406] [ENSMUST00000113117] [ENSMUST00000113119] [ENSMUST00000113121] [ENSMUST00000113122] [ENSMUST00000136263] [ENSMUST00000203577] [ENSMUST00000204198] [ENSMUST00000204626] [ENSMUST00000204834]
Predicted Effect probably damaging
Transcript: ENSMUST00000032406
AA Change: C28R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032406
Gene: ENSMUSG00000030271
AA Change: C28R

DomainStartEndE-ValueType
Pfam:OGG_N 25 141 4e-38 PFAM
ENDO3c 146 316 4.84e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113117
SMART Domains Protein: ENSMUSP00000108742
Gene: ENSMUSG00000001632

DomainStartEndE-ValueType
ZnF_C2H2 21 47 2.63e0 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 105 254 1e-35 PFAM
PHD 274 320 7.63e-10 SMART
PHD 384 447 1.05e-7 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1.58e-37 SMART
low complexity region 762 773 N/A INTRINSIC
low complexity region 855 869 N/A INTRINSIC
low complexity region 901 911 N/A INTRINSIC
low complexity region 940 964 N/A INTRINSIC
low complexity region 993 1019 N/A INTRINSIC
low complexity region 1078 1090 N/A INTRINSIC
PWWP 1115 1198 4.1e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113119
SMART Domains Protein: ENSMUSP00000108744
Gene: ENSMUSG00000001632

DomainStartEndE-ValueType
ZnF_C2H2 21 47 2.63e0 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 106 254 8.5e-39 PFAM
PHD 274 320 7.63e-10 SMART
PHD 384 447 1.05e-7 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1.58e-37 SMART
low complexity region 856 870 N/A INTRINSIC
low complexity region 902 912 N/A INTRINSIC
low complexity region 941 965 N/A INTRINSIC
low complexity region 994 1020 N/A INTRINSIC
low complexity region 1079 1091 N/A INTRINSIC
PWWP 1116 1199 4.1e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113121
SMART Domains Protein: ENSMUSP00000108746
Gene: ENSMUSG00000001632

DomainStartEndE-ValueType
ZnF_C2H2 21 47 2.63e0 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 105 254 5.5e-36 PFAM
PHD 274 320 7.63e-10 SMART
PHD 384 447 1.05e-7 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1.58e-37 SMART
low complexity region 856 870 N/A INTRINSIC
low complexity region 902 912 N/A INTRINSIC
low complexity region 941 965 N/A INTRINSIC
low complexity region 994 1020 N/A INTRINSIC
PWWP 1082 1165 4.1e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113122
SMART Domains Protein: ENSMUSP00000108747
Gene: ENSMUSG00000001632

DomainStartEndE-ValueType
ZnF_C2H2 21 47 2.63e0 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 105 254 5.5e-36 PFAM
PHD 274 320 7.63e-10 SMART
PHD 384 447 1.05e-7 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1.58e-37 SMART
low complexity region 762 773 N/A INTRINSIC
low complexity region 855 869 N/A INTRINSIC
low complexity region 901 911 N/A INTRINSIC
low complexity region 940 964 N/A INTRINSIC
low complexity region 993 1019 N/A INTRINSIC
PWWP 1081 1164 4.1e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131594
Predicted Effect probably damaging
Transcript: ENSMUST00000136263
AA Change: C28R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144792
Gene: ENSMUSG00000030271
AA Change: C28R

DomainStartEndE-ValueType
Pfam:OGG_N 25 130 3e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156734
Predicted Effect probably benign
Transcript: ENSMUST00000203577
SMART Domains Protein: ENSMUSP00000144820
Gene: ENSMUSG00000001632

DomainStartEndE-ValueType
ZnF_C2H2 21 47 1.2e-2 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 106 254 5.1e-36 PFAM
PHD 274 320 4.9e-12 SMART
PHD 384 447 6.8e-10 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 739 1.3e-34 SMART
low complexity region 768 779 N/A INTRINSIC
low complexity region 861 875 N/A INTRINSIC
low complexity region 907 917 N/A INTRINSIC
low complexity region 946 970 N/A INTRINSIC
low complexity region 999 1025 N/A INTRINSIC
low complexity region 1084 1096 N/A INTRINSIC
PWWP 1121 1204 2.6e-44 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203721
Predicted Effect probably benign
Transcript: ENSMUST00000204198
SMART Domains Protein: ENSMUSP00000144804
Gene: ENSMUSG00000001632

DomainStartEndE-ValueType
ZnF_C2H2 21 47 1.2e-2 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 106 254 4.4e-36 PFAM
PHD 274 320 4.9e-12 SMART
PHD 384 447 6.8e-10 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1e-39 SMART
low complexity region 856 870 N/A INTRINSIC
low complexity region 899 925 N/A INTRINSIC
PWWP 987 1070 2.6e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204626
SMART Domains Protein: ENSMUSP00000145093
Gene: ENSMUSG00000001632

DomainStartEndE-ValueType
ZnF_C2H2 21 47 1.2e-2 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 106 254 4.9e-36 PFAM
PHD 274 320 4.9e-12 SMART
PHD 384 447 6.8e-10 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 739 1.3e-34 SMART
low complexity region 768 779 N/A INTRINSIC
low complexity region 861 875 N/A INTRINSIC
low complexity region 907 917 N/A INTRINSIC
low complexity region 946 970 N/A INTRINSIC
low complexity region 999 1025 N/A INTRINSIC
PWWP 1087 1170 2.6e-44 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204834
AA Change: C28R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144905
Gene: ENSMUSG00000030271
AA Change: C28R

DomainStartEndE-ValueType
Pfam:OGG_N 25 134 1.2e-27 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme responsible for the excision of 8-oxoguanine, a mutagenic base byproduct which occurs as a result of exposure to reactive oxygen. The action of this enzyme includes lyase activity for chain cleavage. Alternative splicing of the C-terminal region of this gene classifies splice variants into two major groups, type 1 and type 2, depending on the last exon of the sequence. Type 1 alternative splice variants end with exon 7 and type 2 end with exon 8. All variants share the N-terminal region in common, which contains a mitochondrial targeting signal that is essential for mitochondrial localization. Many alternative splice variants for this gene have been described, but the full-length nature for every variant has not been determined. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to accumulation of 8-hydroxyguanine and altered DNA repair. Mice homozygous for a knock-out allele remain healthy until at least 18 months of age. Mice homozygous for another knock-out allele develop spontaneouslung adenoma/carcinoma at ~1.5 years of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 T C 8: 24,884,455 E507G probably damaging Het
Adam39 C T 8: 40,824,731 T53I probably benign Het
Adam4 A T 12: 81,421,761 S29T possibly damaging Het
Adamdec1 C A 14: 68,577,904 E104* probably null Het
Alas1 G T 9: 106,236,477 P523Q probably damaging Het
Aldh3a1 A G 11: 61,213,494 D69G probably benign Het
Arhgap29 T A 3: 122,014,971 V1266E probably damaging Het
Bcdin3d T C 15: 99,470,838 D160G probably damaging Het
Btaf1 T A 19: 36,978,372 F569I probably benign Het
Cacna1b A G 2: 24,631,944 L1718S probably damaging Het
Casd1 A G 6: 4,629,975 Y457C probably damaging Het
Creb3 T C 4: 43,563,192 V97A probably benign Het
Cux2 G T 5: 121,887,476 S43* probably null Het
Fam160a1 A T 3: 85,730,713 V93D probably damaging Het
Fsbp T G 4: 11,579,841 N36K probably benign Het
Gm11565 A G 11: 99,915,214 D144G probably benign Het
Gm7534 G A 4: 134,200,347 A365V probably benign Het
Gpn3 A G 5: 122,373,918 Y19C probably damaging Het
Gstz1 A T 12: 87,162,063 T148S probably benign Het
Gtf3c5 A G 2: 28,572,224 I282T probably benign Het
Hspa2 T A 12: 76,405,740 S403T possibly damaging Het
Il27 G A 7: 126,591,079 T121I possibly damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Kctd1 T A 18: 15,063,227 probably benign Het
Kynu A G 2: 43,679,803 T366A probably damaging Het
Lama5 G A 2: 180,199,266 T507I probably damaging Het
Myh11 C T 16: 14,269,241 V124M probably damaging Het
Myh14 T A 7: 44,624,330 H1331L probably damaging Het
Myh2 T A 11: 67,188,477 L957Q probably damaging Het
Myh4 T C 11: 67,246,401 F483L probably benign Het
Nbeal1 A C 1: 60,329,390 K2631N probably damaging Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr1449 G A 19: 12,935,097 A120T probably damaging Het
Olfr157 T C 4: 43,836,430 H20R probably benign Het
Olfr181 C T 16: 58,925,690 V294I possibly damaging Het
Olfr49 C T 14: 54,282,332 A188T possibly damaging Het
Olfr855 A G 9: 19,585,430 K298E possibly damaging Het
Parp6 G C 9: 59,640,110 R460P probably damaging Het
Phf14 A G 6: 11,992,057 H744R probably damaging Het
Pibf1 A G 14: 99,133,351 N263S possibly damaging Het
Plcb4 A G 2: 135,932,271 T158A possibly damaging Het
Plce1 T C 19: 38,749,396 S1615P possibly damaging Het
Plxna3 T G X: 74,338,948 probably null Het
Rad54b T A 4: 11,609,449 H633Q probably benign Het
Rgs22 T A 15: 36,099,933 Y212F probably benign Het
Rnd3 G A 2: 51,132,541 A163V probably benign Het
Rnf10 A T 5: 115,251,089 V315E probably damaging Het
Robo2 C T 16: 73,904,378 probably null Het
Rp1l1 T G 14: 64,031,270 V1435G probably damaging Het
Scaf8 T A 17: 3,197,985 D1194E probably benign Het
Sept12 T C 16: 4,991,943 T198A probably damaging Het
Shisa2 A G 14: 59,630,180 T294A probably damaging Het
Spta1 A G 1: 174,191,062 probably null Het
Strbp A T 2: 37,645,679 S6T probably damaging Het
Syf2 A G 4: 134,934,493 E56G probably damaging Het
Thap4 T C 1: 93,714,866 probably benign Het
Tnfaip3 T C 10: 19,011,832 probably benign Het
Tnxb A G 17: 34,672,540 E619G probably damaging Het
Tpr G A 1: 150,423,567 A1173T probably benign Het
Tspan3 G A 9: 56,136,696 R240W probably damaging Het
Ubr4 C T 4: 139,410,716 S1128L probably damaging Het
Ucp1 T C 8: 83,295,247 V236A probably damaging Het
Usp34 TCACCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCACCAC 11: 23,364,480 probably benign Het
Zcchc6 G T 13: 59,796,845 T658K probably damaging Het
Zfp940 T C 7: 29,845,438 D348G probably benign Het
Other mutations in Ogg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03171:Ogg1 APN 6 113333414 missense possibly damaging 0.90
IGL03180:Ogg1 APN 6 113333494 critical splice donor site probably null
R0270:Ogg1 UTSW 6 113329256 missense probably benign 0.00
R0883:Ogg1 UTSW 6 113328420 missense probably damaging 1.00
R2107:Ogg1 UTSW 6 113329293 missense probably damaging 1.00
R3618:Ogg1 UTSW 6 113328373 missense probably damaging 1.00
R3771:Ogg1 UTSW 6 113333843 missense possibly damaging 0.47
R4609:Ogg1 UTSW 6 113328432 missense probably damaging 0.99
R5580:Ogg1 UTSW 6 113329376 missense probably damaging 1.00
R7028:Ogg1 UTSW 6 113329276 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACACCGGACCCATAAGCTAGG -3'
(R):5'- AAACCACCGGTGCTTAGACTC -3'

Sequencing Primer
(F):5'- CATAAGCTAGGACCCACGGTG -3'
(R):5'- CGGTGCTTAGACTCCAAAATG -3'
Posted On2015-10-08