Incidental Mutation 'R4674:Ash1l'
ID 348679
Institutional Source Beutler Lab
Gene Symbol Ash1l
Ensembl Gene ENSMUSG00000028053
Gene Name ASH1 like histone lysine methyltransferase
Synonyms E430018P19Rik, 8030453L17Rik, KMT2H, chromatin remodeling factor
MMRRC Submission 041929-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4674 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 88857929-88986682 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 88979783 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 2769 (V2769A)
Ref Sequence ENSEMBL: ENSMUSP00000140251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090933] [ENSMUST00000186583]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000090933
AA Change: V2769A

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088451
Gene: ENSMUSG00000028053
AA Change: V2769A

DomainStartEndE-ValueType
low complexity region 36 46 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
internal_repeat_1 238 306 6.88e-12 PROSPERO
internal_repeat_1 306 406 6.88e-12 PROSPERO
low complexity region 552 571 N/A INTRINSIC
low complexity region 706 717 N/A INTRINSIC
low complexity region 745 753 N/A INTRINSIC
low complexity region 777 791 N/A INTRINSIC
AT_hook 823 835 3.06e2 SMART
low complexity region 859 873 N/A INTRINSIC
AT_hook 885 897 9.15e0 SMART
low complexity region 938 948 N/A INTRINSIC
low complexity region 1086 1105 N/A INTRINSIC
low complexity region 1107 1121 N/A INTRINSIC
low complexity region 1159 1173 N/A INTRINSIC
low complexity region 1262 1273 N/A INTRINSIC
low complexity region 1288 1301 N/A INTRINSIC
AT_hook 1345 1357 3.09e-1 SMART
low complexity region 1377 1388 N/A INTRINSIC
low complexity region 1395 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
low complexity region 1678 1692 N/A INTRINSIC
AT_hook 1843 1855 1.03e1 SMART
low complexity region 1971 1983 N/A INTRINSIC
AWS 2081 2133 3.95e-26 SMART
SET 2135 2257 8.04e-45 SMART
PostSET 2259 2275 6.38e-2 SMART
low complexity region 2296 2316 N/A INTRINSIC
BROMO 2431 2541 8.29e-23 SMART
low complexity region 2549 2563 N/A INTRINSIC
PHD 2576 2618 8.25e-6 SMART
BAH 2650 2787 1.18e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000186583
AA Change: V2769A

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140251
Gene: ENSMUSG00000028053
AA Change: V2769A

DomainStartEndE-ValueType
low complexity region 36 46 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
internal_repeat_1 238 306 6.88e-12 PROSPERO
internal_repeat_1 306 406 6.88e-12 PROSPERO
low complexity region 552 571 N/A INTRINSIC
low complexity region 706 717 N/A INTRINSIC
low complexity region 745 753 N/A INTRINSIC
low complexity region 777 791 N/A INTRINSIC
AT_hook 823 835 3.06e2 SMART
low complexity region 859 873 N/A INTRINSIC
AT_hook 885 897 9.15e0 SMART
low complexity region 938 948 N/A INTRINSIC
low complexity region 1086 1105 N/A INTRINSIC
low complexity region 1107 1121 N/A INTRINSIC
low complexity region 1159 1173 N/A INTRINSIC
low complexity region 1262 1273 N/A INTRINSIC
low complexity region 1288 1301 N/A INTRINSIC
AT_hook 1345 1357 3.09e-1 SMART
low complexity region 1377 1388 N/A INTRINSIC
low complexity region 1395 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
low complexity region 1678 1692 N/A INTRINSIC
AT_hook 1843 1855 1.03e1 SMART
low complexity region 1971 1983 N/A INTRINSIC
AWS 2081 2133 3.95e-26 SMART
SET 2135 2257 8.04e-45 SMART
PostSET 2259 2275 6.38e-2 SMART
low complexity region 2296 2316 N/A INTRINSIC
BROMO 2431 2541 8.29e-23 SMART
low complexity region 2549 2563 N/A INTRINSIC
PHD 2576 2618 8.25e-6 SMART
BAH 2650 2787 1.18e-23 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the trithorax group of transcriptional activators. The protein contains four AT hooks, a SET domain, a PHD-finger motif, and a bromodomain. It is localized to many small speckles in the nucleus, and also to cell-cell tight junctions. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a transposon-induced allele are more susceptible to endotoxin shock, sepsis, and autoimmune disease. Homozygotes for a hypomorphic allele show reduced growth and postnatal lethality; surviving adults lack Meibomian glands and show vertebral, reproductive organ, and fertility defects. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,860,615 (GRCm39) I112T probably benign Het
Acvr1b T C 15: 101,100,939 (GRCm39) I367T possibly damaging Het
Akr1b8 G A 6: 34,333,359 (GRCm39) probably null Het
Asxl3 A T 18: 22,650,795 (GRCm39) D928V probably damaging Het
Atp1a4 A T 1: 172,085,223 (GRCm39) V66E possibly damaging Het
Cald1 AAGAGAGAGAGAGAG AAGAGAGAGAGAG 6: 34,723,108 (GRCm39) probably null Het
Cbx2 T A 11: 118,919,935 (GRCm39) I500N probably damaging Het
Ccdc82 A T 9: 13,252,260 (GRCm39) H184L probably benign Het
Cd84 A T 1: 171,700,887 (GRCm39) H216L possibly damaging Het
Ceacam15 T C 7: 16,407,410 (GRCm39) T36A probably benign Het
Cebpd A G 16: 15,705,385 (GRCm39) D66G probably damaging Het
Clec1b C A 6: 129,377,097 (GRCm39) L47I probably damaging Het
Cracr2b A G 7: 141,043,451 (GRCm39) D43G probably damaging Het
Crbn T A 6: 106,767,932 (GRCm39) Q173L possibly damaging Het
Cspg4 T C 9: 56,805,489 (GRCm39) V2100A probably damaging Het
Cyp46a1 T C 12: 108,324,345 (GRCm39) L374P probably damaging Het
Dhx16 T A 17: 36,196,831 (GRCm39) V607E probably damaging Het
Dido1 A G 2: 180,329,352 (GRCm39) S357P probably damaging Het
Dnah6 T A 6: 73,169,405 (GRCm39) I399F probably benign Het
Dock10 T C 1: 80,584,337 (GRCm39) E123G possibly damaging Het
Dstyk A G 1: 132,391,128 (GRCm39) D843G probably benign Het
Efcab12 C A 6: 115,800,610 (GRCm39) V138F probably damaging Het
Egf A G 3: 129,511,689 (GRCm39) F493L probably damaging Het
Ephx1 A G 1: 180,822,256 (GRCm39) F220S probably damaging Het
Exoc6 T C 19: 37,597,530 (GRCm39) F644L probably damaging Het
F13b A G 1: 139,429,542 (GRCm39) Y20C unknown Het
Fam184b T A 5: 45,740,230 (GRCm39) K319* probably null Het
Flrt2 T A 12: 95,747,462 (GRCm39) L600* probably null Het
Gbgt1 T C 2: 28,388,453 (GRCm39) F46S possibly damaging Het
Gli2 T C 1: 118,763,759 (GRCm39) E1464G probably damaging Het
Hdac9 A G 12: 34,423,959 (GRCm39) V501A possibly damaging Het
Heca T C 10: 17,791,057 (GRCm39) H333R probably benign Het
Hirip3 G A 7: 126,463,834 (GRCm39) probably null Het
Igsf8 G A 1: 172,146,479 (GRCm39) W51* probably null Het
Kif21a C A 15: 90,824,748 (GRCm39) R1342L possibly damaging Het
Krt73 T C 15: 101,710,510 (GRCm39) N75D probably benign Het
Macf1 T A 4: 123,366,190 (GRCm39) Y1292F probably benign Het
Macroh2a1 A C 13: 56,230,997 (GRCm39) C297G possibly damaging Het
Mapk14 A G 17: 28,963,996 (GRCm39) probably null Het
Mgat5 T A 1: 127,318,495 (GRCm39) V330D probably damaging Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Naip1 A T 13: 100,580,682 (GRCm39) F188L probably damaging Het
Ncoa3 T C 2: 165,901,731 (GRCm39) S1035P probably benign Het
Ndn T A 7: 61,998,570 (GRCm39) W139R probably damaging Het
Nes T C 3: 87,879,102 (GRCm39) V198A possibly damaging Het
Or4c107 G T 2: 88,789,216 (GRCm39) M135I probably damaging Het
Or4c35 A G 2: 89,808,250 (GRCm39) I43V possibly damaging Het
Or51ab3 T G 7: 103,201,183 (GRCm39) L64V probably damaging Het
Or52p1 T A 7: 104,267,631 (GRCm39) C248* probably null Het
Or5b111 T A 19: 13,291,178 (GRCm39) H157L probably benign Het
Or5p72 T C 7: 108,022,309 (GRCm39) V177A possibly damaging Het
Pcf11 G A 7: 92,308,985 (GRCm39) probably benign Het
Pde1a TCC TC 2: 79,728,525 (GRCm39) probably benign Het
Pipox T G 11: 77,784,596 (GRCm39) Q4P probably benign Het
Pla2g4c C T 7: 13,077,439 (GRCm39) T327I probably null Het
Plppr1 C T 4: 49,323,384 (GRCm39) R225W probably damaging Het
Pnpla6 T A 8: 3,571,412 (GRCm39) V145D probably damaging Het
Pnpla7 T C 2: 24,942,329 (GRCm39) Y83H probably damaging Het
Rif1 T A 2: 51,996,954 (GRCm39) L970Q probably null Het
Rimklb C A 6: 122,433,242 (GRCm39) E303* probably null Het
Rpl13a A T 7: 44,776,242 (GRCm39) probably benign Het
Rttn T A 18: 89,029,135 (GRCm39) probably null Het
Sf3b3 G A 8: 111,571,137 (GRCm39) R10W probably damaging Het
Skint4 G A 4: 111,975,430 (GRCm39) C130Y probably damaging Het
Snap91 A G 9: 86,674,070 (GRCm39) S593P possibly damaging Het
Ssb A G 2: 69,699,194 (GRCm39) Q209R probably benign Het
Stap1 A T 5: 86,229,044 (GRCm39) I71L probably benign Het
Syna C A 5: 134,587,209 (GRCm39) R580L probably damaging Het
Tacc2 T A 7: 130,226,591 (GRCm39) M1111K possibly damaging Het
Tanc2 T C 11: 105,758,306 (GRCm39) L689P probably damaging Het
Tasor2 T C 13: 3,623,686 (GRCm39) E1406G possibly damaging Het
Tcstv7b T C 13: 120,702,362 (GRCm39) W53R probably damaging Het
Tdrd5 A C 1: 156,105,005 (GRCm39) C463W probably damaging Het
Tet1 A G 10: 62,674,627 (GRCm39) F1150L probably damaging Het
Tia1 T A 6: 86,397,382 (GRCm39) F118L probably damaging Het
Trav3-1 A T 14: 52,818,460 (GRCm39) T45S possibly damaging Het
Uaca A T 9: 60,761,711 (GRCm39) Y235F possibly damaging Het
Ube4b T C 4: 149,415,827 (GRCm39) N44S possibly damaging Het
Vmn2r93 T A 17: 18,525,255 (GRCm39) H304Q probably benign Het
Wdr18 A G 10: 79,801,069 (GRCm39) I161V probably benign Het
Zfp112 A G 7: 23,826,399 (GRCm39) H789R probably damaging Het
Zfp873 A G 10: 81,895,814 (GRCm39) T182A possibly damaging Het
Zscan2 T A 7: 80,525,150 (GRCm39) S290R probably damaging Het
Zup1 A T 10: 33,824,980 (GRCm39) D167E possibly damaging Het
Other mutations in Ash1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Ash1l APN 3 88,889,019 (GRCm39) missense probably benign 0.19
IGL00819:Ash1l APN 3 88,915,043 (GRCm39) missense possibly damaging 0.68
IGL00939:Ash1l APN 3 88,942,543 (GRCm39) missense probably damaging 0.99
IGL01064:Ash1l APN 3 88,979,791 (GRCm39) missense probably damaging 1.00
IGL01066:Ash1l APN 3 88,891,942 (GRCm39) missense probably damaging 1.00
IGL01087:Ash1l APN 3 88,971,209 (GRCm39) missense probably damaging 1.00
IGL01293:Ash1l APN 3 88,890,836 (GRCm39) missense probably benign 0.01
IGL01541:Ash1l APN 3 88,973,572 (GRCm39) missense probably damaging 1.00
IGL01863:Ash1l APN 3 88,892,813 (GRCm39) nonsense probably null
IGL02326:Ash1l APN 3 88,873,364 (GRCm39) missense probably benign 0.00
IGL02407:Ash1l APN 3 88,979,855 (GRCm39) missense probably damaging 1.00
IGL02419:Ash1l APN 3 88,892,872 (GRCm39) missense probably benign 0.00
IGL02422:Ash1l APN 3 88,976,386 (GRCm39) critical splice donor site probably null
IGL02494:Ash1l APN 3 88,973,525 (GRCm39) nonsense probably null
IGL02727:Ash1l APN 3 88,930,344 (GRCm39) missense probably benign
IGL02732:Ash1l APN 3 88,873,535 (GRCm39) missense probably damaging 1.00
IGL02817:Ash1l APN 3 88,892,108 (GRCm39) missense probably damaging 1.00
IGL02887:Ash1l APN 3 88,891,488 (GRCm39) missense probably benign 0.11
IGL03224:Ash1l APN 3 88,942,575 (GRCm39) splice site probably benign
IGL03253:Ash1l APN 3 88,891,981 (GRCm39) missense probably damaging 1.00
IGL03327:Ash1l APN 3 88,930,390 (GRCm39) missense probably benign 0.02
IGL03398:Ash1l APN 3 88,914,527 (GRCm39) missense probably benign 0.01
3-1:Ash1l UTSW 3 88,873,633 (GRCm39) missense probably benign
BB008:Ash1l UTSW 3 88,950,848 (GRCm39) missense probably damaging 1.00
BB018:Ash1l UTSW 3 88,950,848 (GRCm39) missense probably damaging 1.00
R0068:Ash1l UTSW 3 88,914,624 (GRCm39) missense probably benign 0.17
R0068:Ash1l UTSW 3 88,914,624 (GRCm39) missense probably benign 0.17
R0239:Ash1l UTSW 3 88,974,529 (GRCm39) missense possibly damaging 0.49
R0239:Ash1l UTSW 3 88,974,529 (GRCm39) missense possibly damaging 0.49
R0395:Ash1l UTSW 3 88,965,896 (GRCm39) missense probably damaging 1.00
R0477:Ash1l UTSW 3 88,890,766 (GRCm39) missense probably benign 0.41
R0528:Ash1l UTSW 3 88,889,584 (GRCm39) missense probably benign
R0543:Ash1l UTSW 3 88,971,085 (GRCm39) splice site probably null
R0855:Ash1l UTSW 3 88,961,761 (GRCm39) missense possibly damaging 0.82
R1147:Ash1l UTSW 3 88,892,194 (GRCm39) missense possibly damaging 0.72
R1147:Ash1l UTSW 3 88,892,194 (GRCm39) missense possibly damaging 0.72
R1163:Ash1l UTSW 3 88,942,570 (GRCm39) critical splice donor site probably null
R1196:Ash1l UTSW 3 88,890,623 (GRCm39) missense probably damaging 0.99
R1419:Ash1l UTSW 3 88,892,204 (GRCm39) missense probably damaging 0.99
R1445:Ash1l UTSW 3 88,914,659 (GRCm39) missense probably benign 0.02
R1466:Ash1l UTSW 3 88,959,372 (GRCm39) missense probably damaging 1.00
R1466:Ash1l UTSW 3 88,959,372 (GRCm39) missense probably damaging 1.00
R1480:Ash1l UTSW 3 88,892,359 (GRCm39) missense probably damaging 1.00
R1506:Ash1l UTSW 3 88,965,806 (GRCm39) missense probably damaging 0.99
R1537:Ash1l UTSW 3 88,979,783 (GRCm39) missense probably damaging 0.99
R1584:Ash1l UTSW 3 88,959,372 (GRCm39) missense probably damaging 1.00
R1669:Ash1l UTSW 3 88,974,549 (GRCm39) critical splice donor site probably null
R1713:Ash1l UTSW 3 88,983,531 (GRCm39) missense probably damaging 1.00
R1780:Ash1l UTSW 3 88,873,291 (GRCm39) missense probably benign
R1793:Ash1l UTSW 3 88,977,616 (GRCm39) missense probably damaging 1.00
R1881:Ash1l UTSW 3 88,888,862 (GRCm39) missense probably benign 0.00
R1909:Ash1l UTSW 3 88,891,835 (GRCm39) missense probably benign 0.29
R1938:Ash1l UTSW 3 88,891,729 (GRCm39) missense probably damaging 0.98
R2035:Ash1l UTSW 3 88,973,624 (GRCm39) missense probably benign 0.00
R2070:Ash1l UTSW 3 88,873,510 (GRCm39) missense probably damaging 1.00
R2071:Ash1l UTSW 3 88,873,510 (GRCm39) missense probably damaging 1.00
R2114:Ash1l UTSW 3 88,890,571 (GRCm39) missense probably benign 0.00
R2116:Ash1l UTSW 3 88,890,571 (GRCm39) missense probably benign 0.00
R2118:Ash1l UTSW 3 88,892,602 (GRCm39) missense possibly damaging 0.80
R2143:Ash1l UTSW 3 88,892,726 (GRCm39) missense probably benign 0.09
R2164:Ash1l UTSW 3 88,892,726 (GRCm39) missense probably benign 0.09
R2210:Ash1l UTSW 3 88,973,605 (GRCm39) missense probably damaging 1.00
R2247:Ash1l UTSW 3 88,914,674 (GRCm39) missense possibly damaging 0.77
R2303:Ash1l UTSW 3 88,933,733 (GRCm39) missense probably damaging 1.00
R2860:Ash1l UTSW 3 88,961,785 (GRCm39) missense probably damaging 1.00
R2861:Ash1l UTSW 3 88,961,785 (GRCm39) missense probably damaging 1.00
R3104:Ash1l UTSW 3 88,961,693 (GRCm39) missense probably damaging 1.00
R4133:Ash1l UTSW 3 88,889,567 (GRCm39) missense probably benign 0.00
R4164:Ash1l UTSW 3 88,889,273 (GRCm39) missense probably damaging 0.97
R4270:Ash1l UTSW 3 88,889,347 (GRCm39) missense probably benign 0.26
R4271:Ash1l UTSW 3 88,889,347 (GRCm39) missense probably benign 0.26
R4287:Ash1l UTSW 3 88,973,722 (GRCm39) missense probably damaging 0.99
R4409:Ash1l UTSW 3 88,914,506 (GRCm39) missense probably damaging 0.99
R4459:Ash1l UTSW 3 88,873,541 (GRCm39) missense probably damaging 0.99
R4487:Ash1l UTSW 3 88,892,622 (GRCm39) missense possibly damaging 0.65
R4739:Ash1l UTSW 3 88,890,152 (GRCm39) missense probably benign 0.19
R4927:Ash1l UTSW 3 88,892,641 (GRCm39) missense probably damaging 1.00
R5000:Ash1l UTSW 3 88,965,941 (GRCm39) missense probably damaging 1.00
R5016:Ash1l UTSW 3 88,889,630 (GRCm39) missense probably damaging 1.00
R5055:Ash1l UTSW 3 88,930,519 (GRCm39) critical splice donor site probably null
R5081:Ash1l UTSW 3 88,892,024 (GRCm39) missense probably damaging 1.00
R5082:Ash1l UTSW 3 88,873,541 (GRCm39) missense probably damaging 0.99
R5090:Ash1l UTSW 3 88,960,184 (GRCm39) missense probably damaging 1.00
R5113:Ash1l UTSW 3 88,973,582 (GRCm39) missense probably damaging 0.99
R5408:Ash1l UTSW 3 88,889,701 (GRCm39) missense probably damaging 1.00
R5452:Ash1l UTSW 3 88,892,183 (GRCm39) missense possibly damaging 0.93
R5487:Ash1l UTSW 3 88,888,733 (GRCm39) missense probably benign 0.17
R5610:Ash1l UTSW 3 88,930,492 (GRCm39) missense probably damaging 1.00
R5624:Ash1l UTSW 3 88,892,916 (GRCm39) missense probably damaging 1.00
R5682:Ash1l UTSW 3 88,914,914 (GRCm39) missense probably damaging 0.99
R5712:Ash1l UTSW 3 88,959,297 (GRCm39) missense probably damaging 0.99
R5719:Ash1l UTSW 3 88,965,933 (GRCm39) missense probably damaging 1.00
R5719:Ash1l UTSW 3 88,961,805 (GRCm39) missense possibly damaging 0.83
R5839:Ash1l UTSW 3 88,890,658 (GRCm39) missense probably damaging 0.99
R5859:Ash1l UTSW 3 88,976,300 (GRCm39) missense probably damaging 1.00
R5877:Ash1l UTSW 3 88,888,891 (GRCm39) missense probably benign 0.00
R5940:Ash1l UTSW 3 88,891,343 (GRCm39) missense probably damaging 0.96
R6026:Ash1l UTSW 3 88,892,326 (GRCm39) missense probably damaging 1.00
R6027:Ash1l UTSW 3 88,892,326 (GRCm39) missense probably damaging 1.00
R6029:Ash1l UTSW 3 88,892,326 (GRCm39) missense probably damaging 1.00
R6033:Ash1l UTSW 3 88,892,326 (GRCm39) missense probably damaging 1.00
R6033:Ash1l UTSW 3 88,892,326 (GRCm39) missense probably damaging 1.00
R6034:Ash1l UTSW 3 88,892,326 (GRCm39) missense probably damaging 1.00
R6034:Ash1l UTSW 3 88,892,326 (GRCm39) missense probably damaging 1.00
R6035:Ash1l UTSW 3 88,892,326 (GRCm39) missense probably damaging 1.00
R6035:Ash1l UTSW 3 88,892,326 (GRCm39) missense probably damaging 1.00
R6089:Ash1l UTSW 3 88,960,450 (GRCm39) nonsense probably null
R6110:Ash1l UTSW 3 88,892,436 (GRCm39) missense probably damaging 1.00
R6168:Ash1l UTSW 3 88,960,080 (GRCm39) nonsense probably null
R6200:Ash1l UTSW 3 88,977,834 (GRCm39) missense probably damaging 1.00
R6290:Ash1l UTSW 3 88,890,068 (GRCm39) nonsense probably null
R6331:Ash1l UTSW 3 88,915,172 (GRCm39) missense probably benign 0.00
R6425:Ash1l UTSW 3 88,891,087 (GRCm39) missense probably damaging 0.99
R6540:Ash1l UTSW 3 88,892,368 (GRCm39) missense probably damaging 1.00
R6568:Ash1l UTSW 3 88,959,344 (GRCm39) missense probably benign 0.09
R6828:Ash1l UTSW 3 88,983,420 (GRCm39) missense probably benign 0.00
R6843:Ash1l UTSW 3 88,892,695 (GRCm39) missense probably damaging 1.00
R6894:Ash1l UTSW 3 88,890,298 (GRCm39) missense probably benign 0.00
R6976:Ash1l UTSW 3 88,888,964 (GRCm39) missense possibly damaging 0.77
R7038:Ash1l UTSW 3 88,889,978 (GRCm39) missense probably benign 0.00
R7073:Ash1l UTSW 3 88,892,647 (GRCm39) missense probably damaging 1.00
R7133:Ash1l UTSW 3 88,890,764 (GRCm39) frame shift probably null
R7150:Ash1l UTSW 3 88,984,381 (GRCm39) missense probably damaging 1.00
R7205:Ash1l UTSW 3 88,873,259 (GRCm39) missense probably benign 0.00
R7254:Ash1l UTSW 3 88,977,816 (GRCm39) missense probably damaging 1.00
R7272:Ash1l UTSW 3 88,961,941 (GRCm39) splice site probably null
R7288:Ash1l UTSW 3 88,873,199 (GRCm39) start gained probably benign
R7319:Ash1l UTSW 3 88,888,694 (GRCm39) missense probably benign 0.19
R7341:Ash1l UTSW 3 88,889,066 (GRCm39) missense possibly damaging 0.93
R7342:Ash1l UTSW 3 88,873,304 (GRCm39) missense possibly damaging 0.94
R7454:Ash1l UTSW 3 88,891,172 (GRCm39) missense probably benign 0.16
R7677:Ash1l UTSW 3 88,950,500 (GRCm39) missense probably damaging 1.00
R7822:Ash1l UTSW 3 88,914,571 (GRCm39) missense probably benign
R7857:Ash1l UTSW 3 88,891,616 (GRCm39) nonsense probably null
R7889:Ash1l UTSW 3 88,873,345 (GRCm39) missense probably benign 0.00
R7898:Ash1l UTSW 3 88,890,932 (GRCm39) missense possibly damaging 0.54
R7931:Ash1l UTSW 3 88,950,848 (GRCm39) missense probably damaging 1.00
R7937:Ash1l UTSW 3 88,977,624 (GRCm39) nonsense probably null
R7973:Ash1l UTSW 3 88,960,164 (GRCm39) missense probably benign
R8119:Ash1l UTSW 3 88,942,734 (GRCm39) missense probably damaging 1.00
R8157:Ash1l UTSW 3 88,971,014 (GRCm39) critical splice donor site probably null
R8162:Ash1l UTSW 3 88,977,553 (GRCm39) missense probably damaging 0.99
R8194:Ash1l UTSW 3 88,960,062 (GRCm39) missense probably damaging 1.00
R8306:Ash1l UTSW 3 88,873,259 (GRCm39) missense probably benign 0.00
R8497:Ash1l UTSW 3 88,914,951 (GRCm39) missense probably benign 0.02
R8558:Ash1l UTSW 3 88,891,713 (GRCm39) missense probably damaging 0.96
R8744:Ash1l UTSW 3 88,965,890 (GRCm39) missense possibly damaging 0.89
R8923:Ash1l UTSW 3 88,892,974 (GRCm39) missense possibly damaging 0.51
R8969:Ash1l UTSW 3 88,873,598 (GRCm39) missense possibly damaging 0.52
R8970:Ash1l UTSW 3 88,976,307 (GRCm39) missense probably benign 0.00
R9002:Ash1l UTSW 3 88,888,715 (GRCm39) missense probably benign 0.17
R9023:Ash1l UTSW 3 88,892,576 (GRCm39) missense probably damaging 1.00
R9032:Ash1l UTSW 3 88,891,529 (GRCm39) missense probably benign 0.00
R9032:Ash1l UTSW 3 88,889,294 (GRCm39) missense probably benign 0.19
R9049:Ash1l UTSW 3 88,914,671 (GRCm39) missense probably benign
R9085:Ash1l UTSW 3 88,891,529 (GRCm39) missense probably benign 0.00
R9085:Ash1l UTSW 3 88,889,294 (GRCm39) missense probably benign 0.19
R9130:Ash1l UTSW 3 88,965,848 (GRCm39) nonsense probably null
R9149:Ash1l UTSW 3 88,914,530 (GRCm39) missense probably benign
R9294:Ash1l UTSW 3 88,890,297 (GRCm39) missense possibly damaging 0.90
R9365:Ash1l UTSW 3 88,889,207 (GRCm39) missense possibly damaging 0.63
R9450:Ash1l UTSW 3 88,915,139 (GRCm39) missense possibly damaging 0.86
R9542:Ash1l UTSW 3 88,950,566 (GRCm39) missense probably damaging 1.00
R9558:Ash1l UTSW 3 88,889,521 (GRCm39) missense probably benign 0.02
R9572:Ash1l UTSW 3 88,960,188 (GRCm39) missense probably damaging 1.00
R9688:Ash1l UTSW 3 88,892,024 (GRCm39) missense probably damaging 1.00
R9736:Ash1l UTSW 3 88,891,733 (GRCm39) missense probably damaging 1.00
R9765:Ash1l UTSW 3 88,930,500 (GRCm39) missense probably damaging 1.00
R9789:Ash1l UTSW 3 88,873,373 (GRCm39) missense probably benign
X0017:Ash1l UTSW 3 88,891,892 (GRCm39) missense probably benign 0.45
X0019:Ash1l UTSW 3 88,977,863 (GRCm39) missense probably damaging 1.00
X0021:Ash1l UTSW 3 88,890,511 (GRCm39) missense probably benign 0.10
Z1088:Ash1l UTSW 3 88,890,016 (GRCm39) missense probably benign 0.00
Z1176:Ash1l UTSW 3 88,950,524 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACTGGGTTGATTTTGGAAAC -3'
(R):5'- AGCAAGGCCTCAAGCATTATG -3'

Sequencing Primer
(F):5'- CAGGGCTTCTCTATATAGACCAGG -3'
(R):5'- TTCATGATCAGCTGAACCAAGTGG -3'
Posted On 2015-10-08