Incidental Mutation 'R4674:Tet1'
ID348720
Institutional Source Beutler Lab
Gene Symbol Tet1
Ensembl Gene ENSMUSG00000047146
Gene Nametet methylcytosine dioxygenase 1
SynonymsBB001228, 2510010B09Rik, D10Ertd17e, Cxxc6
MMRRC Submission 041929-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4674 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location62804570-62908996 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62838848 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1150 (F1150L)
Ref Sequence ENSEMBL: ENSMUSP00000133279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050826] [ENSMUST00000174189]
Predicted Effect probably benign
Transcript: ENSMUST00000050826
AA Change: F1150L

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000059527
Gene: ENSMUSG00000047146
AA Change: F1150L

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
Pfam:zf-CXXC 566 607 2.5e-11 PFAM
low complexity region 884 902 N/A INTRINSIC
low complexity region 1087 1106 N/A INTRINSIC
Tet_JBP 1528 1931 1e-171 SMART
low complexity region 1944 1956 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173081
Predicted Effect probably damaging
Transcript: ENSMUST00000174189
AA Change: F1150L

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133279
Gene: ENSMUSG00000047146
AA Change: F1150L

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
Pfam:zf-CXXC 566 607 2.7e-10 PFAM
low complexity region 884 902 N/A INTRINSIC
low complexity region 1087 1106 N/A INTRINSIC
Tet_JBP 1528 1963 7.36e-170 SMART
low complexity region 1976 1988 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNA methylation is an epigenetic mechanism that is important for controlling gene expression. The protein encoded by this gene is a demethylase that belongs to the TET (ten-eleven translocation) family. Members of the TET protein family play a role in the DNA methylation process and gene activation. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit background sensitive lethality, abnormal forebrain development, abnormal female reproductive organs and decreased litter size. Mice homozygous for a different knock-out allele exhibit impaired adult neurogenesis, impaired spatial learning and impaired short-term memory retention. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,810,615 I112T probably benign Het
Acvr1b T C 15: 101,203,058 I367T possibly damaging Het
Akr1b8 G A 6: 34,356,424 probably null Het
Ash1l T C 3: 89,072,476 V2769A possibly damaging Het
Asxl3 A T 18: 22,517,738 D928V probably damaging Het
Atp1a4 A T 1: 172,257,656 V66E possibly damaging Het
Cald1 AAGAGAGAGAGAGAG AAGAGAGAGAGAG 6: 34,746,173 probably null Het
Cbx2 T A 11: 119,029,109 I500N probably damaging Het
Ccdc82 A T 9: 13,252,635 H184L probably benign Het
Cd84 A T 1: 171,873,320 H216L possibly damaging Het
Ceacam15 T C 7: 16,673,485 T36A probably benign Het
Cebpd A G 16: 15,887,521 D66G probably damaging Het
Clec1b C A 6: 129,400,134 L47I probably damaging Het
Cracr2b A G 7: 141,463,538 D43G probably damaging Het
Crbn T A 6: 106,790,971 Q173L possibly damaging Het
Cspg4 T C 9: 56,898,205 V2100A probably damaging Het
Cyp46a1 T C 12: 108,358,086 L374P probably damaging Het
Dhx16 T A 17: 35,885,939 V607E probably damaging Het
Dido1 A G 2: 180,687,559 S357P probably damaging Het
Dnah6 T A 6: 73,192,422 I399F probably benign Het
Dock10 T C 1: 80,606,620 E123G possibly damaging Het
Dstyk A G 1: 132,463,390 D843G probably benign Het
Efcab12 C A 6: 115,823,649 V138F probably damaging Het
Egf A G 3: 129,718,040 F493L probably damaging Het
Ephx1 A G 1: 180,994,691 F220S probably damaging Het
Exoc6 T C 19: 37,609,082 F644L probably damaging Het
F13b A G 1: 139,501,804 Y20C unknown Het
Fam184b T A 5: 45,582,888 K319* probably null Het
Fam208b T C 13: 3,573,686 E1406G possibly damaging Het
Flrt2 T A 12: 95,780,688 L600* probably null Het
Gbgt1 T C 2: 28,498,441 F46S possibly damaging Het
Gli2 T C 1: 118,836,029 E1464G probably damaging Het
Gm21731 T C 13: 120,240,826 W53R probably damaging Het
H2afy A C 13: 56,083,184 C297G possibly damaging Het
Hdac9 A G 12: 34,373,960 V501A possibly damaging Het
Heca T C 10: 17,915,309 H333R probably benign Het
Hirip3 G A 7: 126,864,662 probably null Het
Igsf8 G A 1: 172,318,912 W51* probably null Het
Kif21a C A 15: 90,940,545 R1342L possibly damaging Het
Krt73 T C 15: 101,802,075 N75D probably benign Het
Macf1 T A 4: 123,472,397 Y1292F probably benign Het
Mapk14 A G 17: 28,745,022 probably null Het
Mgat5 T A 1: 127,390,758 V330D probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Naip1 A T 13: 100,444,174 F188L probably damaging Het
Ncoa3 T C 2: 166,059,811 S1035P probably benign Het
Ndn T A 7: 62,348,822 W139R probably damaging Het
Nes T C 3: 87,971,795 V198A possibly damaging Het
Olfr1212 G T 2: 88,958,872 M135I probably damaging Het
Olfr1260 A G 2: 89,977,906 I43V possibly damaging Het
Olfr1465 T A 19: 13,313,814 H157L probably benign Het
Olfr497 T C 7: 108,423,102 V177A possibly damaging Het
Olfr613 T G 7: 103,551,976 L64V probably damaging Het
Olfr656 T A 7: 104,618,424 C248* probably null Het
Pcf11 G A 7: 92,659,777 probably benign Het
Pde1a TCC TC 2: 79,898,181 probably benign Het
Pipox T G 11: 77,893,770 Q4P probably benign Het
Pla2g4c C T 7: 13,343,514 T327I probably null Het
Plppr1 C T 4: 49,323,384 R225W probably damaging Het
Pnpla6 T A 8: 3,521,412 V145D probably damaging Het
Pnpla7 T C 2: 25,052,317 Y83H probably damaging Het
Rif1 T A 2: 52,106,942 L970Q probably null Het
Rimklb C A 6: 122,456,283 E303* probably null Het
Rpl13a A T 7: 45,126,818 probably benign Het
Rttn T A 18: 89,011,011 probably null Het
Sf3b3 G A 8: 110,844,505 R10W probably damaging Het
Skint4 G A 4: 112,118,233 C130Y probably damaging Het
Snap91 A G 9: 86,792,017 S593P possibly damaging Het
Ssb A G 2: 69,868,850 Q209R probably benign Het
Stap1 A T 5: 86,081,185 I71L probably benign Het
Syna C A 5: 134,558,355 R580L probably damaging Het
Tacc2 T A 7: 130,624,861 M1111K possibly damaging Het
Tanc2 T C 11: 105,867,480 L689P probably damaging Het
Tdrd5 A C 1: 156,277,435 C463W probably damaging Het
Tia1 T A 6: 86,420,400 F118L probably damaging Het
Trav3-1 A T 14: 52,581,003 T45S possibly damaging Het
Uaca A T 9: 60,854,429 Y235F possibly damaging Het
Ube4b T C 4: 149,331,370 N44S possibly damaging Het
Vmn2r93 T A 17: 18,304,993 H304Q probably benign Het
Wdr18 A G 10: 79,965,235 I161V probably benign Het
Zfp112 A G 7: 24,126,974 H789R probably damaging Het
Zfp873 A G 10: 82,059,980 T182A possibly damaging Het
Zscan2 T A 7: 80,875,402 S290R probably damaging Het
Zufsp A T 10: 33,948,984 D167E possibly damaging Het
Other mutations in Tet1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Tet1 APN 10 62814497 missense probably damaging 1.00
IGL01079:Tet1 APN 10 62879473 missense probably damaging 0.99
IGL01109:Tet1 APN 10 62879774 missense probably benign
IGL01634:Tet1 APN 10 62878588 missense possibly damaging 0.94
IGL02003:Tet1 APN 10 62816400 missense possibly damaging 0.92
IGL02081:Tet1 APN 10 62813818 missense probably damaging 1.00
IGL02100:Tet1 APN 10 62812728 missense possibly damaging 0.92
IGL02228:Tet1 APN 10 62813734 missense probably damaging 0.99
IGL02524:Tet1 APN 10 62878646 missense probably damaging 1.00
IGL02539:Tet1 APN 10 62813019 missense possibly damaging 0.60
IGL02608:Tet1 APN 10 62879609 missense possibly damaging 0.82
IGL02608:Tet1 APN 10 62839087 missense probably damaging 1.00
IGL02702:Tet1 APN 10 62879752 missense possibly damaging 0.83
K7371:Tet1 UTSW 10 62879176 missense probably benign
R0166:Tet1 UTSW 10 62840279 missense probably benign 0.05
R0371:Tet1 UTSW 10 62878399 missense probably damaging 0.97
R0373:Tet1 UTSW 10 62878209 nonsense probably null
R0391:Tet1 UTSW 10 62814546 unclassified probably null
R0445:Tet1 UTSW 10 62879941 missense probably benign 0.08
R1016:Tet1 UTSW 10 62879950 missense probably benign
R1344:Tet1 UTSW 10 62814521 missense probably damaging 1.00
R1546:Tet1 UTSW 10 62812910 missense probably damaging 1.00
R1651:Tet1 UTSW 10 62879674 missense probably damaging 1.00
R1725:Tet1 UTSW 10 62814477 missense probably damaging 1.00
R1752:Tet1 UTSW 10 62812989 missense probably damaging 0.99
R1834:Tet1 UTSW 10 62813665 missense probably damaging 0.99
R1964:Tet1 UTSW 10 62812947 missense possibly damaging 0.86
R2239:Tet1 UTSW 10 62879734 missense probably benign 0.01
R2962:Tet1 UTSW 10 62814544 nonsense probably null
R3084:Tet1 UTSW 10 62879621 missense probably benign 0.34
R3086:Tet1 UTSW 10 62879621 missense probably benign 0.34
R3972:Tet1 UTSW 10 62813726 missense probably damaging 1.00
R4622:Tet1 UTSW 10 62819474 missense possibly damaging 0.92
R4687:Tet1 UTSW 10 62838791 missense probably benign 0.04
R4718:Tet1 UTSW 10 62813812 missense probably damaging 0.96
R4801:Tet1 UTSW 10 62822663 missense probably damaging 0.99
R4802:Tet1 UTSW 10 62822663 missense probably damaging 0.99
R4903:Tet1 UTSW 10 62822658 missense probably damaging 1.00
R5153:Tet1 UTSW 10 62878578 missense possibly damaging 0.85
R5193:Tet1 UTSW 10 62838247 missense probably benign 0.22
R5225:Tet1 UTSW 10 62838671 missense probably damaging 1.00
R5437:Tet1 UTSW 10 62814451 missense probably benign 0.01
R5465:Tet1 UTSW 10 62839777 missense probably benign
R5535:Tet1 UTSW 10 62832907 missense probably damaging 1.00
R5586:Tet1 UTSW 10 62878294 missense probably damaging 1.00
R5763:Tet1 UTSW 10 62840068 missense probably damaging 1.00
R5788:Tet1 UTSW 10 62839958 missense possibly damaging 0.70
R5818:Tet1 UTSW 10 62816408 missense possibly damaging 0.71
R5860:Tet1 UTSW 10 62812620 unclassified probably null
R5975:Tet1 UTSW 10 62879773 missense probably benign 0.37
R6041:Tet1 UTSW 10 62813373 missense probably damaging 0.98
R6092:Tet1 UTSW 10 62813715 missense probably benign 0.10
R6132:Tet1 UTSW 10 62813300 missense probably damaging 0.99
R6157:Tet1 UTSW 10 62839970 missense probably damaging 0.98
R6520:Tet1 UTSW 10 62880013 start codon destroyed probably null 0.53
R7210:Tet1 UTSW 10 62814501 missense probably null 0.95
R7223:Tet1 UTSW 10 62813671 missense possibly damaging 0.95
R7255:Tet1 UTSW 10 62822636 missense probably benign 0.15
R7323:Tet1 UTSW 10 62880039 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CCACCGGATTCTGTCTTGAATTG -3'
(R):5'- AGTGTACCATCAGCAAAGCC -3'

Sequencing Primer
(F):5'- GAGAATCTGATGGTTCAACCTTCAC -3'
(R):5'- GTGTACCATCAGCAAAGCCAAAGAAG -3'
Posted On2015-10-08