Incidental Mutation 'R4626:Mcm6'
ID348748
Institutional Source Beutler Lab
Gene Symbol Mcm6
Ensembl Gene ENSMUSG00000026355
Gene Nameminichromosome maintenance complex component 6
SynonymsD1Wsu22e, Mcmd6
MMRRC Submission 041891-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4626 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location128331590-128359664 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128351548 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 167 (D167G)
Ref Sequence ENSEMBL: ENSMUSP00000140308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027601] [ENSMUST00000190495]
Predicted Effect probably benign
Transcript: ENSMUST00000027601
AA Change: D167G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000027601
Gene: ENSMUSG00000026355
AA Change: D167G

DomainStartEndE-ValueType
MCM 119 657 1.43e-270 SMART
PDB:2LE8|A 710 821 1e-47 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000190495
AA Change: D167G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000140308
Gene: ENSMUSG00000026355
AA Change: D167G

DomainStartEndE-ValueType
MCM 119 657 1.43e-270 SMART
PDB:2LE8|A 710 783 3e-29 PDB
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by the MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. The MCM complex consisting of this protein and MCM2, 4 and 7 proteins possesses DNA helicase activity, and may act as a DNA unwinding enzyme. The phosphorylation of the complex by CDC2 kinase reduces the helicase activity, suggesting a role in the regulation of DNA replication. Single nucleotide polymorphisms in the intron regions of this gene are associated with differential transcriptional activation of the promoter of the neighboring lactase gene and, thereby, influence lactose intolerance in early adulthood. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit increased micronulei-containing red blood cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf A C 11: 84,422,958 *527G probably null Het
Abca17 A T 17: 24,321,084 I390N probably damaging Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd49 A C 9: 14,782,640 L77R probably damaging Het
Ap3b1 T A 13: 94,404,078 N169K possibly damaging Het
Arhgap39 A C 15: 76,737,637 F255V possibly damaging Het
Atp1a3 T A 7: 24,998,768 N171I possibly damaging Het
Atp9a T C 2: 168,639,943 D953G probably damaging Het
Atxn1 T C 13: 45,567,099 Y440C probably damaging Het
Bccip T C 7: 133,720,728 Y268H possibly damaging Het
Brms1l C A 12: 55,863,173 P243T probably benign Het
Btbd10 T C 7: 113,328,398 E250G probably damaging Het
Cacna1e T C 1: 154,482,548 probably null Het
Cfhr2 A T 1: 139,813,576 N220K probably damaging Het
Csnk1g2 C A 10: 80,639,814 A405E probably damaging Het
D5Ertd579e T C 5: 36,614,559 I831V possibly damaging Het
F2 T A 2: 91,630,670 N239I probably benign Het
Fbln5 T A 12: 101,760,827 D301V probably damaging Het
Fbn2 A T 18: 58,013,747 C2692* probably null Het
Fhdc1 C T 3: 84,474,250 D34N probably damaging Het
Galnt13 T A 2: 54,857,866 M253K probably damaging Het
Gm11127 CTGGGTG CTG 17: 36,057,896 probably null Het
Gpc6 C A 14: 117,964,843 Y488* probably null Het
Grm5 G T 7: 88,130,153 G934C probably damaging Het
Gys1 T C 7: 45,439,534 L119S probably damaging Het
Htra4 T C 8: 25,037,114 N222D probably benign Het
Iba57 A G 11: 59,158,461 V294A probably benign Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lama5 G A 2: 180,184,460 T2330M probably damaging Het
Lrguk G A 6: 34,129,223 E728K probably benign Het
Mettl18 T A 1: 163,996,476 V122E probably damaging Het
Mindy2 G A 9: 70,626,781 S378L probably damaging Het
Mis18bp1 G T 12: 65,140,766 F854L probably damaging Het
Mtdh C T 15: 34,114,834 R106* probably null Het
Nup214 T A 2: 32,033,404 V1315E possibly damaging Het
Nupl1 A G 14: 60,238,555 V271A probably benign Het
Olfr1188 T C 2: 88,559,832 V121A possibly damaging Het
Olfr3 A G 2: 36,812,259 Y278H probably damaging Het
Olfr523 T C 7: 140,176,446 S109P probably damaging Het
Orc5 G T 5: 22,548,005 F10L probably benign Het
Pcdha11 A T 18: 37,006,998 N560I probably damaging Het
Pcdhb9 T A 18: 37,402,249 F432Y probably benign Het
Peg10 GGATCC GGATCCCCATCAAGATCC 6: 4,756,460 probably benign Het
Poll C A 19: 45,555,124 M385I probably benign Het
Pomt1 A G 2: 32,254,412 K737E possibly damaging Het
Prr16 C T 18: 51,302,839 T130I probably damaging Het
Ptpn18 A G 1: 34,471,792 probably null Het
Ranbp6 A T 19: 29,810,863 Y696* probably null Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Scn10a A G 9: 119,631,505 I1101T possibly damaging Het
Slc22a22 T C 15: 57,263,338 T93A probably damaging Het
Snx10 A G 6: 51,588,290 D129G probably damaging Het
Stub1 A G 17: 25,831,871 probably null Het
Tfr2 T C 5: 137,571,692 V120A probably benign Het
Trmu T C 15: 85,894,985 Y278H possibly damaging Het
Ugt2b36 A C 5: 87,092,088 F146C probably damaging Het
Vav2 T C 2: 27,270,160 I692V possibly damaging Het
Wdfy3 A G 5: 101,943,934 L513P probably damaging Het
Zfhx4 T A 3: 5,402,639 V2619D probably damaging Het
Zfyve26 T A 12: 79,269,070 N1211Y possibly damaging Het
Zp3r A G 1: 130,615,175 F142L probably damaging Het
Other mutations in Mcm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Mcm6 APN 1 128344383 missense probably damaging 1.00
IGL01420:Mcm6 APN 1 128345875 missense probably damaging 1.00
IGL01746:Mcm6 APN 1 128353524 nonsense probably null
IGL02256:Mcm6 APN 1 128335728 critical splice donor site probably null
IGL02624:Mcm6 APN 1 128349448 missense possibly damaging 0.91
IGL02732:Mcm6 APN 1 128359490 missense probably benign 0.16
IGL02750:Mcm6 APN 1 128343472 missense probably damaging 1.00
IGL02926:Mcm6 APN 1 128339382 missense probably damaging 1.00
IGL03189:Mcm6 APN 1 128344302 missense probably damaging 1.00
IGL03238:Mcm6 APN 1 128355520 missense probably benign 0.13
IGL03397:Mcm6 APN 1 128344302 missense probably damaging 1.00
R0453:Mcm6 UTSW 1 128333555 missense probably benign 0.00
R0501:Mcm6 UTSW 1 128355636 missense probably benign 0.03
R0885:Mcm6 UTSW 1 128348933 missense probably benign 0.00
R1013:Mcm6 UTSW 1 128349041 missense probably benign
R1319:Mcm6 UTSW 1 128349052 missense probably benign
R1396:Mcm6 UTSW 1 128351476 missense probably damaging 1.00
R1656:Mcm6 UTSW 1 128349418 missense possibly damaging 0.90
R1891:Mcm6 UTSW 1 128335810 missense probably damaging 1.00
R1950:Mcm6 UTSW 1 128345989 missense probably benign 0.35
R3411:Mcm6 UTSW 1 128351585 missense probably benign 0.35
R4564:Mcm6 UTSW 1 128343459 missense probably damaging 1.00
R4627:Mcm6 UTSW 1 128351548 missense probably benign 0.01
R4628:Mcm6 UTSW 1 128351548 missense probably benign 0.01
R4916:Mcm6 UTSW 1 128348977 missense probably damaging 1.00
R4965:Mcm6 UTSW 1 128359486 missense probably damaging 1.00
R4967:Mcm6 UTSW 1 128335849 missense probably damaging 1.00
R5016:Mcm6 UTSW 1 128343427 missense probably damaging 1.00
R5204:Mcm6 UTSW 1 128333638 missense probably benign 0.01
R5229:Mcm6 UTSW 1 128333584 missense possibly damaging 0.82
R5607:Mcm6 UTSW 1 128355589 missense probably damaging 1.00
R5811:Mcm6 UTSW 1 128335728 critical splice donor site probably benign
R5816:Mcm6 UTSW 1 128348455 missense probably benign 0.01
R7204:Mcm6 UTSW 1 128338127 missense probably damaging 1.00
R7316:Mcm6 UTSW 1 128359508 missense probably damaging 1.00
Z1088:Mcm6 UTSW 1 128344298 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACCTTCTGGCCTCTGTGG -3'
(R):5'- AATCCCTGGAACTGAAGTGGGG -3'

Sequencing Primer
(F):5'- GTGGGCACTACATTCCTTAAAAACTG -3'
(R):5'- CCTGGAACTGAAGTGGGGAAAGG -3'
Posted On2015-10-08