Incidental Mutation 'R4626:Adamts18'
ID 348787
Institutional Source Beutler Lab
Gene Symbol Adamts18
Ensembl Gene ENSMUSG00000053399
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 18
Synonyms E130314N14Rik
MMRRC Submission 041891-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.127) question?
Stock # R4626 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 114423758-114575370 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 114499800 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Stop codon at position 371 (W371*)
Ref Sequence ENSEMBL: ENSMUSP00000090801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093113] [ENSMUST00000212665]
AlphaFold Q4VC17
Predicted Effect probably null
Transcript: ENSMUST00000093113
AA Change: W371*
SMART Domains Protein: ENSMUSP00000090801
Gene: ENSMUSG00000053399
AA Change: W371*

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
Pfam:Pep_M12B_propep 63 203 3.4e-37 PFAM
Pfam:Reprolysin_5 292 473 1.3e-14 PFAM
Pfam:Reprolysin_4 294 494 2.6e-11 PFAM
Pfam:Reprolysin 294 498 2.7e-30 PFAM
Pfam:Reprolysin_2 311 488 1.7e-14 PFAM
Pfam:Reprolysin_3 315 447 1.5e-11 PFAM
TSP1 592 644 7.37e-17 SMART
Pfam:ADAM_spacer1 749 861 1.7e-38 PFAM
TSP1 878 932 1.55e-1 SMART
TSP1 934 992 5.07e-6 SMART
TSP1 994 1049 1.65e-5 SMART
TSP1 1055 1116 1.71e-3 SMART
TSP1 1125 1171 5.27e-4 SMART
Pfam:PLAC 1186 1216 1.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212527
Predicted Effect probably benign
Transcript: ENSMUST00000212665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213078
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. ADAMTS family members share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protein, which may regulate hemostatic balance and function as a tumor suppressor. Mutations in this gene may be associated with microcornea, myopic chorioretinal atrophy, and telecanthus (MMCAT) and cone-rod dystrophy in human patients. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a floxed allele exhibit some fertility defects. Mice homozygous for a null allele exhibit growth and eye defects and increased susceptibility to chemically induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf A C 11: 84,313,784 (GRCm39) *527G probably null Het
Abca17 A T 17: 24,540,058 (GRCm39) I390N probably damaging Het
Akr1c13 G T 13: 4,247,869 (GRCm39) V214F probably damaging Het
Alkbh2 C T 5: 114,262,287 (GRCm39) E148K probably damaging Het
Ankrd49 A C 9: 14,693,936 (GRCm39) L77R probably damaging Het
Ap3b1 T A 13: 94,540,586 (GRCm39) N169K possibly damaging Het
Arhgap39 A C 15: 76,621,837 (GRCm39) F255V possibly damaging Het
Atp1a3 T A 7: 24,698,193 (GRCm39) N171I possibly damaging Het
Atp9a T C 2: 168,481,863 (GRCm39) D953G probably damaging Het
Atxn1 T C 13: 45,720,575 (GRCm39) Y440C probably damaging Het
Bccip T C 7: 133,322,457 (GRCm39) Y268H possibly damaging Het
Brms1l C A 12: 55,909,958 (GRCm39) P243T probably benign Het
Btbd10 T C 7: 112,927,605 (GRCm39) E250G probably damaging Het
Cacna1e T C 1: 154,358,294 (GRCm39) probably null Het
Cfhr2 A T 1: 139,741,314 (GRCm39) N220K probably damaging Het
Csnk1g2 C A 10: 80,475,648 (GRCm39) A405E probably damaging Het
D5Ertd579e T C 5: 36,771,903 (GRCm39) I831V possibly damaging Het
F2 T A 2: 91,461,015 (GRCm39) N239I probably benign Het
Fbln5 T A 12: 101,727,086 (GRCm39) D301V probably damaging Het
Fbn2 A T 18: 58,146,819 (GRCm39) C2692* probably null Het
Fhdc1 C T 3: 84,381,557 (GRCm39) D34N probably damaging Het
Galnt13 T A 2: 54,747,878 (GRCm39) M253K probably damaging Het
Gpc6 C A 14: 118,202,255 (GRCm39) Y488* probably null Het
Grm5 G T 7: 87,779,361 (GRCm39) G934C probably damaging Het
Gys1 T C 7: 45,088,958 (GRCm39) L119S probably damaging Het
H2-T15 CTGGGTG CTG 17: 36,368,788 (GRCm39) probably null Het
Htra4 T C 8: 25,527,130 (GRCm39) N222D probably benign Het
Iba57 A G 11: 59,049,287 (GRCm39) V294A probably benign Het
Kctd21 A G 7: 96,996,782 (GRCm39) D85G probably damaging Het
Krt1 C T 15: 101,754,622 (GRCm39) G543S unknown Het
Lama5 G A 2: 179,826,253 (GRCm39) T2330M probably damaging Het
Lrguk G A 6: 34,106,158 (GRCm39) E728K probably benign Het
Mcm6 T C 1: 128,279,285 (GRCm39) D167G probably benign Het
Mettl18 T A 1: 163,824,045 (GRCm39) V122E probably damaging Het
Mindy2 G A 9: 70,534,063 (GRCm39) S378L probably damaging Het
Mis18bp1 G T 12: 65,187,540 (GRCm39) F854L probably damaging Het
Mtdh C T 15: 34,114,980 (GRCm39) R106* probably null Het
Nup214 T A 2: 31,923,416 (GRCm39) V1315E possibly damaging Het
Nup58 A G 14: 60,476,004 (GRCm39) V271A probably benign Het
Or1j1 A G 2: 36,702,271 (GRCm39) Y278H probably damaging Het
Or4c101 T C 2: 88,390,176 (GRCm39) V121A possibly damaging Het
Or6f2 T C 7: 139,756,359 (GRCm39) S109P probably damaging Het
Orc5 G T 5: 22,753,003 (GRCm39) F10L probably benign Het
Pcdha11 A T 18: 37,140,051 (GRCm39) N560I probably damaging Het
Pcdhb9 T A 18: 37,535,302 (GRCm39) F432Y probably benign Het
Peg10 GGATCC GGATCCCCATCAAGATCC 6: 4,756,460 (GRCm39) probably benign Het
Poll C A 19: 45,543,563 (GRCm39) M385I probably benign Het
Pomt1 A G 2: 32,144,424 (GRCm39) K737E possibly damaging Het
Prr16 C T 18: 51,435,911 (GRCm39) T130I probably damaging Het
Ptpn18 A G 1: 34,510,873 (GRCm39) probably null Het
Ranbp6 A T 19: 29,788,263 (GRCm39) Y696* probably null Het
Rmi1 A G 13: 58,556,950 (GRCm39) R400G probably benign Het
Scn10a A G 9: 119,460,571 (GRCm39) I1101T possibly damaging Het
Slc22a22 T C 15: 57,126,734 (GRCm39) T93A probably damaging Het
Snx10 A G 6: 51,565,270 (GRCm39) D129G probably damaging Het
Stub1 A G 17: 26,050,845 (GRCm39) probably null Het
Tfr2 T C 5: 137,569,954 (GRCm39) V120A probably benign Het
Trmu T C 15: 85,779,186 (GRCm39) Y278H possibly damaging Het
Ugt2b36 A C 5: 87,239,947 (GRCm39) F146C probably damaging Het
Vav2 T C 2: 27,160,172 (GRCm39) I692V possibly damaging Het
Wdfy3 A G 5: 102,091,800 (GRCm39) L513P probably damaging Het
Zfhx4 T A 3: 5,467,699 (GRCm39) V2619D probably damaging Het
Zfyve26 T A 12: 79,315,844 (GRCm39) N1211Y possibly damaging Het
Zp3r A G 1: 130,542,912 (GRCm39) F142L probably damaging Het
Other mutations in Adamts18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01290:Adamts18 APN 8 114,501,575 (GRCm39) missense probably damaging 1.00
IGL01548:Adamts18 APN 8 114,490,931 (GRCm39) missense probably damaging 1.00
IGL01556:Adamts18 APN 8 114,571,741 (GRCm39) missense probably benign 0.01
IGL01833:Adamts18 APN 8 114,469,728 (GRCm39) missense probably benign 0.10
IGL02187:Adamts18 APN 8 114,439,826 (GRCm39) missense possibly damaging 0.93
IGL02551:Adamts18 APN 8 114,425,704 (GRCm39) missense probably damaging 1.00
IGL02756:Adamts18 APN 8 114,440,976 (GRCm39) splice site probably benign
IGL03188:Adamts18 APN 8 114,425,656 (GRCm39) missense probably damaging 1.00
IGL03411:Adamts18 APN 8 114,490,929 (GRCm39) nonsense probably null
G1patch:Adamts18 UTSW 8 114,469,833 (GRCm39) missense probably damaging 1.00
R0119:Adamts18 UTSW 8 114,501,585 (GRCm39) missense possibly damaging 0.94
R0378:Adamts18 UTSW 8 114,469,749 (GRCm39) missense probably damaging 1.00
R0410:Adamts18 UTSW 8 114,440,990 (GRCm39) nonsense probably null
R0480:Adamts18 UTSW 8 114,465,450 (GRCm39) missense possibly damaging 0.93
R0514:Adamts18 UTSW 8 114,465,401 (GRCm39) splice site probably null
R0924:Adamts18 UTSW 8 114,432,028 (GRCm39) splice site probably null
R0930:Adamts18 UTSW 8 114,432,028 (GRCm39) splice site probably null
R1333:Adamts18 UTSW 8 114,431,805 (GRCm39) splice site probably benign
R1441:Adamts18 UTSW 8 114,481,194 (GRCm39) critical splice donor site probably null
R2082:Adamts18 UTSW 8 114,501,965 (GRCm39) missense probably damaging 1.00
R2146:Adamts18 UTSW 8 114,571,635 (GRCm39) missense possibly damaging 0.58
R2371:Adamts18 UTSW 8 114,431,893 (GRCm39) missense probably benign 0.36
R3148:Adamts18 UTSW 8 114,465,490 (GRCm39) missense probably damaging 1.00
R3963:Adamts18 UTSW 8 114,504,443 (GRCm39) missense probably benign 0.00
R4056:Adamts18 UTSW 8 114,464,212 (GRCm39) nonsense probably null
R4486:Adamts18 UTSW 8 114,439,825 (GRCm39) missense probably benign 0.00
R4608:Adamts18 UTSW 8 114,464,245 (GRCm39) missense probably damaging 1.00
R4624:Adamts18 UTSW 8 114,499,800 (GRCm39) nonsense probably null
R4627:Adamts18 UTSW 8 114,499,800 (GRCm39) nonsense probably null
R4628:Adamts18 UTSW 8 114,499,800 (GRCm39) nonsense probably null
R4629:Adamts18 UTSW 8 114,499,800 (GRCm39) nonsense probably null
R4710:Adamts18 UTSW 8 114,433,558 (GRCm39) missense probably damaging 0.98
R4959:Adamts18 UTSW 8 114,463,357 (GRCm39) nonsense probably null
R4973:Adamts18 UTSW 8 114,463,357 (GRCm39) nonsense probably null
R4976:Adamts18 UTSW 8 114,425,642 (GRCm39) missense probably benign 0.31
R5119:Adamts18 UTSW 8 114,425,642 (GRCm39) missense probably benign 0.31
R5141:Adamts18 UTSW 8 114,501,902 (GRCm39) missense probably damaging 1.00
R5422:Adamts18 UTSW 8 114,425,606 (GRCm39) missense probably benign 0.06
R5587:Adamts18 UTSW 8 114,501,992 (GRCm39) nonsense probably null
R5868:Adamts18 UTSW 8 114,504,380 (GRCm39) missense possibly damaging 0.69
R5893:Adamts18 UTSW 8 114,499,709 (GRCm39) missense probably damaging 1.00
R5906:Adamts18 UTSW 8 114,436,251 (GRCm39) missense probably benign 0.00
R5942:Adamts18 UTSW 8 114,504,380 (GRCm39) missense probably benign 0.01
R6006:Adamts18 UTSW 8 114,433,606 (GRCm39) missense probably damaging 1.00
R6608:Adamts18 UTSW 8 114,501,911 (GRCm39) missense probably damaging 1.00
R6725:Adamts18 UTSW 8 114,469,833 (GRCm39) missense probably damaging 1.00
R7002:Adamts18 UTSW 8 114,501,922 (GRCm39) missense possibly damaging 0.69
R7276:Adamts18 UTSW 8 114,501,896 (GRCm39) missense probably damaging 0.99
R7292:Adamts18 UTSW 8 114,436,277 (GRCm39) missense probably benign 0.00
R7411:Adamts18 UTSW 8 114,504,362 (GRCm39) missense probably damaging 0.99
R7685:Adamts18 UTSW 8 114,439,855 (GRCm39) missense probably damaging 1.00
R7737:Adamts18 UTSW 8 114,463,566 (GRCm39) splice site probably null
R7860:Adamts18 UTSW 8 114,501,908 (GRCm39) missense probably damaging 1.00
R7936:Adamts18 UTSW 8 114,493,760 (GRCm39) missense probably damaging 1.00
R8197:Adamts18 UTSW 8 114,481,227 (GRCm39) missense probably damaging 1.00
R8363:Adamts18 UTSW 8 114,493,795 (GRCm39) missense probably damaging 1.00
R8759:Adamts18 UTSW 8 114,433,624 (GRCm39) missense probably damaging 1.00
R8934:Adamts18 UTSW 8 114,463,510 (GRCm39) missense possibly damaging 0.90
R9405:Adamts18 UTSW 8 114,430,030 (GRCm39) missense probably damaging 1.00
R9422:Adamts18 UTSW 8 114,501,910 (GRCm39) missense probably damaging 1.00
R9450:Adamts18 UTSW 8 114,490,942 (GRCm39) missense probably benign 0.10
R9475:Adamts18 UTSW 8 114,504,570 (GRCm39) missense possibly damaging 0.93
Z1088:Adamts18 UTSW 8 114,502,072 (GRCm39) missense possibly damaging 0.86
Z1176:Adamts18 UTSW 8 114,469,800 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TGATGAGACTCAAAAGGGCCAC -3'
(R):5'- ATTGGTGCAGCTTAGCTCAG -3'

Sequencing Primer
(F):5'- CACATCCATCGGAAAGTTGTC -3'
(R):5'- TTTTTCCTACTGATAATTTCTCCGAG -3'
Posted On 2015-10-08