Incidental Mutation 'R4626:Aatf'
List |< first << previous [record 27 of 958] next >> last >|
ID348793
Institutional Source Beutler Lab
Gene Symbol Aatf
Ensembl Gene ENSMUSG00000018697
Gene Nameapoptosis antagonizing transcription factor
SynonymsTrb, 4933415H02Rik, 5830465M17Rik, Che-1
MMRRC Submission 041891-MU
Accession Numbers

NCBI RefSeq: NM_019816.1; MGI:1929608

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4626 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location84422855-84513522 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to C at 84422958 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glycine at position 527 (*527G)
Ref Sequence ENSEMBL: ENSMUSP00000018841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018841]
Predicted Effect probably null
Transcript: ENSMUST00000018841
AA Change: *527G
SMART Domains Protein: ENSMUSP00000018841
Gene: ENSMUSG00000018697
AA Change: *527G

DomainStartEndE-ValueType
low complexity region 2 35 N/A INTRINSIC
low complexity region 91 119 N/A INTRINSIC
low complexity region 130 173 N/A INTRINSIC
Pfam:AATF-Che1 187 339 4.6e-40 PFAM
low complexity region 418 429 N/A INTRINSIC
Pfam:TRAUB 430 514 3.2e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127042
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype Strain: 2176283
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified on the basis of its interaction with MAP3K12/DLK, a protein kinase known to be involved in the induction of cell apoptosis. This gene product contains a leucine zipper, which is a characteristic motif of transcription factors, and was shown to exhibit strong transactivation activity when fused to Gal4 DNA binding domain. Overexpression of this gene interfered with MAP3K12 induced apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous embryos do not develop past the compacted morula stage, and after failing to maintain compaction. Mutant embryos show abnormal morphology at E3.5, with most not forming a blastocoel cavity. Severely reduced cell proliferation is observed before blastocyst formation. [provided by MGI curators]
Allele List at MGI

All alleles(20) : Targeted(2) Gene trapped(18

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,321,084 I390N probably damaging Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd49 A C 9: 14,782,640 L77R probably damaging Het
Ap3b1 T A 13: 94,404,078 N169K possibly damaging Het
Arhgap39 A C 15: 76,737,637 F255V possibly damaging Het
Atp1a3 T A 7: 24,998,768 N171I possibly damaging Het
Atp9a T C 2: 168,639,943 D953G probably damaging Het
Atxn1 T C 13: 45,567,099 Y440C probably damaging Het
Bccip T C 7: 133,720,728 Y268H possibly damaging Het
Brms1l C A 12: 55,863,173 P243T probably benign Het
Btbd10 T C 7: 113,328,398 E250G probably damaging Het
Cacna1e T C 1: 154,482,548 probably null Het
Cfhr2 A T 1: 139,813,576 N220K probably damaging Het
Csnk1g2 C A 10: 80,639,814 A405E probably damaging Het
D5Ertd579e T C 5: 36,614,559 I831V possibly damaging Het
F2 T A 2: 91,630,670 N239I probably benign Het
Fbln5 T A 12: 101,760,827 D301V probably damaging Het
Fbn2 A T 18: 58,013,747 C2692* probably null Het
Fhdc1 C T 3: 84,474,250 D34N probably damaging Het
Galnt13 T A 2: 54,857,866 M253K probably damaging Het
Gm11127 CTGGGTG CTG 17: 36,057,896 probably null Het
Gpc6 C A 14: 117,964,843 Y488* probably null Het
Grm5 G T 7: 88,130,153 G934C probably damaging Het
Gys1 T C 7: 45,439,534 L119S probably damaging Het
Htra4 T C 8: 25,037,114 N222D probably benign Het
Iba57 A G 11: 59,158,461 V294A probably benign Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lama5 G A 2: 180,184,460 T2330M probably damaging Het
Lrguk G A 6: 34,129,223 E728K probably benign Het
Mcm6 T C 1: 128,351,548 D167G probably benign Het
Mettl18 T A 1: 163,996,476 V122E probably damaging Het
Mindy2 G A 9: 70,626,781 S378L probably damaging Het
Mis18bp1 G T 12: 65,140,766 F854L probably damaging Het
Mtdh C T 15: 34,114,834 R106* probably null Het
Nup214 T A 2: 32,033,404 V1315E possibly damaging Het
Nupl1 A G 14: 60,238,555 V271A probably benign Het
Olfr1188 T C 2: 88,559,832 V121A possibly damaging Het
Olfr3 A G 2: 36,812,259 Y278H probably damaging Het
Olfr523 T C 7: 140,176,446 S109P probably damaging Het
Orc5 G T 5: 22,548,005 F10L probably benign Het
Pcdha11 A T 18: 37,006,998 N560I probably damaging Het
Pcdhb9 T A 18: 37,402,249 F432Y probably benign Het
Peg10 GGATCC GGATCCCCATCAAGATCC 6: 4,756,460 probably benign Het
Poll C A 19: 45,555,124 M385I probably benign Het
Pomt1 A G 2: 32,254,412 K737E possibly damaging Het
Prr16 C T 18: 51,302,839 T130I probably damaging Het
Ptpn18 A G 1: 34,471,792 probably null Het
Ranbp6 A T 19: 29,810,863 Y696* probably null Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Scn10a A G 9: 119,631,505 I1101T possibly damaging Het
Slc22a22 T C 15: 57,263,338 T93A probably damaging Het
Snx10 A G 6: 51,588,290 D129G probably damaging Het
Stub1 A G 17: 25,831,871 probably null Het
Tfr2 T C 5: 137,571,692 V120A probably benign Het
Trmu T C 15: 85,894,985 Y278H possibly damaging Het
Ugt2b36 A C 5: 87,092,088 F146C probably damaging Het
Vav2 T C 2: 27,270,160 I692V possibly damaging Het
Wdfy3 A G 5: 101,943,934 L513P probably damaging Het
Zfhx4 T A 3: 5,402,639 V2619D probably damaging Het
Zfyve26 T A 12: 79,269,070 N1211Y possibly damaging Het
Zp3r A G 1: 130,615,175 F142L probably damaging Het
Other mutations in Aatf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Aatf APN 11 84470557 splice site probably benign
IGL01482:Aatf APN 11 84470710 missense possibly damaging 0.51
IGL01775:Aatf APN 11 84471137 missense probably damaging 1.00
IGL02881:Aatf APN 11 84471289
R0183:Aatf UTSW 11 84510425 splice site probably null
R0200:Aatf UTSW 11 84445676 missense probably damaging 1.00
R0257:Aatf UTSW 11 84510281 missense probably benign 0.33
R0324:Aatf UTSW 11 84512139 critical splice donor site probably null
R0494:Aatf UTSW 11 84511513 missense probably benign
R0544:Aatf UTSW 11 84423005 missense probably benign 0.09
R1186:Aatf UTSW 11 84470549 splice site probably benign
R2339:Aatf UTSW 11 84511497 missense probably benign 0.00
R4647:Aatf UTSW 11 84471197 missense possibly damaging 0.69
R4697:Aatf UTSW 11 84449138 missense probably damaging 1.00
R4981:Aatf UTSW 11 84511497 missense probably benign 0.00
R5490:Aatf UTSW 11 84510273 missense probably damaging 1.00
R5938:Aatf UTSW 11 84442574 missense possibly damaging 0.88
R6267:Aatf UTSW 11 84473100 missense probably benign 0.09
R6296:Aatf UTSW 11 84473100 missense probably benign 0.09
R6633:Aatf UTSW 11 84511482 critical splice donor site probably null
X0018:Aatf UTSW 11 84510385 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TGGAAACAACCTGAGTGCG -3'
(R):5'- AGTGCTCCGAGATGTGGTTC -3'

Sequencing Primer
(F):5'- ACAACCTGAGTGCGCATGC -3'
(R):5'- CTCCGAGATGTGGTTCTTAATTAC -3'
Posted On2015-10-08