Incidental Mutation 'R4626:Fbn2'
ID348813
Institutional Source Beutler Lab
Gene Symbol Fbn2
Ensembl Gene ENSMUSG00000024598
Gene Namefibrillin 2
SynonymsFib-2, sy, Sne
MMRRC Submission 041891-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.528) question?
Stock #R4626 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location58008623-58209926 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 58013747 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 2692 (C2692*)
Ref Sequence ENSEMBL: ENSMUSP00000025497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025497]
Predicted Effect probably null
Transcript: ENSMUST00000025497
AA Change: C2692*
SMART Domains Protein: ENSMUSP00000025497
Gene: ENSMUSG00000024598
AA Change: C2692*

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 29 52 N/A INTRINSIC
low complexity region 68 77 N/A INTRINSIC
EGF 148 176 1.15e1 SMART
EGF 179 208 1.26e-2 SMART
Pfam:TB 224 262 3.7e-10 PFAM
EGF_CA 276 317 8.3e-12 SMART
EGF_CA 318 359 9.25e-10 SMART
Pfam:TB 374 416 4.3e-13 PFAM
low complexity region 435 450 N/A INTRINSIC
low complexity region 463 475 N/A INTRINSIC
EGF 490 527 1.13e-4 SMART
EGF_CA 528 567 2.26e-13 SMART
EGF_CA 568 609 9.03e-13 SMART
EGF_CA 610 650 6.2e-11 SMART
EGF_CA 651 691 7.75e-12 SMART
Pfam:TB 707 748 5.2e-15 PFAM
EGF_CA 761 802 6.29e-12 SMART
EGF_CA 803 844 1.97e-13 SMART
EGF_CA 845 884 1.61e-9 SMART
Pfam:TB 899 935 1.8e-9 PFAM
EGF_CA 948 989 4.7e-11 SMART
Pfam:TB 1004 1044 1.3e-16 PFAM
EGF_CA 1066 1107 3.05e-10 SMART
EGF_CA 1108 1150 2.19e-11 SMART
EGF_CA 1151 1192 2.04e-11 SMART
EGF_CA 1193 1234 3.15e-12 SMART
EGF_CA 1235 1275 1.82e-8 SMART
EGF_CA 1276 1317 9.91e-10 SMART
EGF_CA 1318 1359 1.48e-8 SMART
EGF_CA 1360 1400 6.54e-10 SMART
EGF_CA 1401 1441 4.63e-10 SMART
EGF_CA 1442 1483 7.75e-12 SMART
EGF_CA 1484 1524 5.23e-9 SMART
EGF_CA 1525 1565 2.13e-9 SMART
Pfam:TB 1585 1625 3.4e-15 PFAM
EGF_CA 1643 1684 6.74e-12 SMART
EGF_CA 1685 1726 1.06e-9 SMART
Pfam:TB 1741 1783 1.2e-17 PFAM
EGF_CA 1801 1842 7.34e-13 SMART
EGF_CA 1843 1884 4.15e-12 SMART
EGF_CA 1885 1926 5.23e-9 SMART
EGF_CA 1927 1965 5.87e-12 SMART
EGF_CA 1966 2008 1.11e-12 SMART
EGF_CA 2009 2048 1.26e-11 SMART
EGF_CA 2049 2090 7.12e-11 SMART
Pfam:TB 2105 2147 1.2e-15 PFAM
EGF_CA 2164 2205 2.89e-11 SMART
EGF_CA 2206 2245 1.1e-11 SMART
EGF_CA 2246 2286 3.76e-10 SMART
EGF_CA 2287 2330 1.44e-6 SMART
EGF_CA 2331 2372 1.16e-10 SMART
Pfam:TB 2387 2429 1.9e-16 PFAM
EGF_CA 2442 2483 8.43e-13 SMART
EGF_CA 2484 2524 4.96e-10 SMART
EGF_CA 2525 2563 7.63e-11 SMART
EGF_CA 2564 2606 6.44e-9 SMART
EGF_CA 2607 2646 2.28e-9 SMART
EGF_CA 2647 2687 1.79e-7 SMART
EGF_CA 2688 2727 3.45e-9 SMART
low complexity region 2774 2786 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of connective tissue microfibrils and may be involved in elastic fiber assembly. Mutations in this gene cause congenital contractural arachnodactyly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous, chemically-induced, and targeted null mutations show bilateral syndactyly with fusion of both soft and hard tissues. Deafness found in an X-ray induced allelic mutant is apparently due to the joint disruption of a linked gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf A C 11: 84,422,958 *527G probably null Het
Abca17 A T 17: 24,321,084 I390N probably damaging Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd49 A C 9: 14,782,640 L77R probably damaging Het
Ap3b1 T A 13: 94,404,078 N169K possibly damaging Het
Arhgap39 A C 15: 76,737,637 F255V possibly damaging Het
Atp1a3 T A 7: 24,998,768 N171I possibly damaging Het
Atp9a T C 2: 168,639,943 D953G probably damaging Het
Atxn1 T C 13: 45,567,099 Y440C probably damaging Het
Bccip T C 7: 133,720,728 Y268H possibly damaging Het
Brms1l C A 12: 55,863,173 P243T probably benign Het
Btbd10 T C 7: 113,328,398 E250G probably damaging Het
Cacna1e T C 1: 154,482,548 probably null Het
Cfhr2 A T 1: 139,813,576 N220K probably damaging Het
Csnk1g2 C A 10: 80,639,814 A405E probably damaging Het
D5Ertd579e T C 5: 36,614,559 I831V possibly damaging Het
F2 T A 2: 91,630,670 N239I probably benign Het
Fbln5 T A 12: 101,760,827 D301V probably damaging Het
Fhdc1 C T 3: 84,474,250 D34N probably damaging Het
Galnt13 T A 2: 54,857,866 M253K probably damaging Het
Gm11127 CTGGGTG CTG 17: 36,057,896 probably null Het
Gpc6 C A 14: 117,964,843 Y488* probably null Het
Grm5 G T 7: 88,130,153 G934C probably damaging Het
Gys1 T C 7: 45,439,534 L119S probably damaging Het
Htra4 T C 8: 25,037,114 N222D probably benign Het
Iba57 A G 11: 59,158,461 V294A probably benign Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lama5 G A 2: 180,184,460 T2330M probably damaging Het
Lrguk G A 6: 34,129,223 E728K probably benign Het
Mcm6 T C 1: 128,351,548 D167G probably benign Het
Mettl18 T A 1: 163,996,476 V122E probably damaging Het
Mindy2 G A 9: 70,626,781 S378L probably damaging Het
Mis18bp1 G T 12: 65,140,766 F854L probably damaging Het
Mtdh C T 15: 34,114,834 R106* probably null Het
Nup214 T A 2: 32,033,404 V1315E possibly damaging Het
Nupl1 A G 14: 60,238,555 V271A probably benign Het
Olfr1188 T C 2: 88,559,832 V121A possibly damaging Het
Olfr3 A G 2: 36,812,259 Y278H probably damaging Het
Olfr523 T C 7: 140,176,446 S109P probably damaging Het
Orc5 G T 5: 22,548,005 F10L probably benign Het
Pcdha11 A T 18: 37,006,998 N560I probably damaging Het
Pcdhb9 T A 18: 37,402,249 F432Y probably benign Het
Peg10 GGATCC GGATCCCCATCAAGATCC 6: 4,756,460 probably benign Het
Poll C A 19: 45,555,124 M385I probably benign Het
Pomt1 A G 2: 32,254,412 K737E possibly damaging Het
Prr16 C T 18: 51,302,839 T130I probably damaging Het
Ptpn18 A G 1: 34,471,792 probably null Het
Ranbp6 A T 19: 29,810,863 Y696* probably null Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Scn10a A G 9: 119,631,505 I1101T possibly damaging Het
Slc22a22 T C 15: 57,263,338 T93A probably damaging Het
Snx10 A G 6: 51,588,290 D129G probably damaging Het
Stub1 A G 17: 25,831,871 probably null Het
Tfr2 T C 5: 137,571,692 V120A probably benign Het
Trmu T C 15: 85,894,985 Y278H possibly damaging Het
Ugt2b36 A C 5: 87,092,088 F146C probably damaging Het
Vav2 T C 2: 27,270,160 I692V possibly damaging Het
Wdfy3 A G 5: 101,943,934 L513P probably damaging Het
Zfhx4 T A 3: 5,402,639 V2619D probably damaging Het
Zfyve26 T A 12: 79,269,070 N1211Y possibly damaging Het
Zp3r A G 1: 130,615,175 F142L probably damaging Het
Other mutations in Fbn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Fbn2 APN 18 58037809 missense possibly damaging 0.81
IGL00780:Fbn2 APN 18 58095988 missense probably damaging 1.00
IGL00923:Fbn2 APN 18 58012325 missense probably benign 0.00
IGL01011:Fbn2 APN 18 58095240 splice site probably benign
IGL01123:Fbn2 APN 18 58104081 missense possibly damaging 0.62
IGL01304:Fbn2 APN 18 58061745 missense probably damaging 0.97
IGL01339:Fbn2 APN 18 58113370 missense possibly damaging 0.75
IGL01465:Fbn2 APN 18 58203833 missense probably null 0.67
IGL01608:Fbn2 APN 18 58053704 nonsense probably null
IGL01682:Fbn2 APN 18 58072671 missense probably damaging 1.00
IGL01752:Fbn2 APN 18 58075977 splice site probably null
IGL01764:Fbn2 APN 18 58045351 missense probably damaging 1.00
IGL02002:Fbn2 APN 18 58114553 missense probably benign 0.01
IGL02010:Fbn2 APN 18 58037722 missense probably damaging 0.99
IGL02029:Fbn2 APN 18 58209603 missense probably benign 0.04
IGL02037:Fbn2 APN 18 58096015 missense probably damaging 1.00
IGL02350:Fbn2 APN 18 58103995 missense possibly damaging 0.71
IGL02357:Fbn2 APN 18 58103995 missense possibly damaging 0.71
IGL02653:Fbn2 APN 18 58076705 missense probably benign
IGL03233:Fbn2 APN 18 58102377 missense probably benign 0.39
IGL03347:Fbn2 APN 18 58013665 missense probably damaging 1.00
IGL03410:Fbn2 APN 18 58050243 missense possibly damaging 0.95
pinch UTSW 18 58069184 missense probably damaging 1.00
stick UTSW 18 58071819 missense possibly damaging 0.94
tweak UTSW 18 58058389 missense probably damaging 1.00
PIT4434001:Fbn2 UTSW 18 58096062 missense probably damaging 0.99
R0020:Fbn2 UTSW 18 58105164 missense probably damaging 1.00
R0069:Fbn2 UTSW 18 58069184 missense probably damaging 1.00
R0107:Fbn2 UTSW 18 58056203 missense probably benign 0.00
R0116:Fbn2 UTSW 18 58102373 nonsense probably null
R0277:Fbn2 UTSW 18 58045317 missense probably damaging 1.00
R0284:Fbn2 UTSW 18 58050290 splice site probably benign
R0316:Fbn2 UTSW 18 58113325 missense probably damaging 1.00
R0323:Fbn2 UTSW 18 58045317 missense probably damaging 1.00
R0421:Fbn2 UTSW 18 58027804 splice site probably benign
R0455:Fbn2 UTSW 18 58035336 missense probably damaging 1.00
R0504:Fbn2 UTSW 18 58039460 missense possibly damaging 0.94
R0520:Fbn2 UTSW 18 58013749 missense probably damaging 1.00
R0632:Fbn2 UTSW 18 58037747 missense probably damaging 1.00
R0638:Fbn2 UTSW 18 58045374 missense probably damaging 0.98
R0645:Fbn2 UTSW 18 58058389 missense probably damaging 1.00
R1051:Fbn2 UTSW 18 58012353 missense probably damaging 0.99
R1209:Fbn2 UTSW 18 58070016 missense probably benign 0.00
R1319:Fbn2 UTSW 18 58200610 missense possibly damaging 0.88
R1400:Fbn2 UTSW 18 58080193 missense possibly damaging 0.90
R1437:Fbn2 UTSW 18 58053659 missense possibly damaging 0.68
R1463:Fbn2 UTSW 18 58010380 missense probably benign
R1612:Fbn2 UTSW 18 58061752 missense probably damaging 1.00
R1623:Fbn2 UTSW 18 58048548 missense possibly damaging 0.61
R1629:Fbn2 UTSW 18 58026538 missense probably damaging 1.00
R1639:Fbn2 UTSW 18 58058462 missense probably benign 0.41
R1722:Fbn2 UTSW 18 58048052 critical splice acceptor site probably null
R1749:Fbn2 UTSW 18 58050276 missense probably benign 0.35
R1802:Fbn2 UTSW 18 58052976 nonsense probably null
R1850:Fbn2 UTSW 18 58039305 splice site probably benign
R1913:Fbn2 UTSW 18 58061742 missense probably damaging 1.00
R2045:Fbn2 UTSW 18 58090658 missense probably damaging 1.00
R2064:Fbn2 UTSW 18 58048849 missense probably damaging 0.99
R2143:Fbn2 UTSW 18 58052993 missense possibly damaging 0.65
R2144:Fbn2 UTSW 18 58052993 missense possibly damaging 0.65
R2149:Fbn2 UTSW 18 58102325 splice site probably null
R2207:Fbn2 UTSW 18 58081399 nonsense probably null
R2219:Fbn2 UTSW 18 58052963 missense possibly damaging 0.79
R2263:Fbn2 UTSW 18 58095176 splice site probably benign
R2375:Fbn2 UTSW 18 58035966 missense probably damaging 1.00
R2424:Fbn2 UTSW 18 58203787 missense probably damaging 0.99
R2504:Fbn2 UTSW 18 58093359 missense probably damaging 0.99
R2879:Fbn2 UTSW 18 58069242 missense probably damaging 0.97
R3040:Fbn2 UTSW 18 58093387 missense probably damaging 1.00
R3080:Fbn2 UTSW 18 58149050 missense probably damaging 0.97
R3625:Fbn2 UTSW 18 58061742 missense probably damaging 1.00
R3901:Fbn2 UTSW 18 58066011 missense probably damaging 0.97
R4089:Fbn2 UTSW 18 58053769 missense probably benign 0.01
R4133:Fbn2 UTSW 18 58095962 missense possibly damaging 0.82
R4155:Fbn2 UTSW 18 58023287 nonsense probably null
R4288:Fbn2 UTSW 18 58035339 missense probably damaging 0.98
R4289:Fbn2 UTSW 18 58035339 missense probably damaging 0.98
R4363:Fbn2 UTSW 18 58149050 missense probably damaging 0.97
R4559:Fbn2 UTSW 18 58076074 missense probably benign 0.00
R4601:Fbn2 UTSW 18 58053733 missense probably damaging 1.00
R4609:Fbn2 UTSW 18 58190269 nonsense probably null
R4638:Fbn2 UTSW 18 58010304 missense probably benign 0.01
R4675:Fbn2 UTSW 18 58040193 missense possibly damaging 0.95
R4707:Fbn2 UTSW 18 58056272 missense probably damaging 1.00
R4758:Fbn2 UTSW 18 58026386 missense probably benign 0.00
R4945:Fbn2 UTSW 18 58050253 missense possibly damaging 0.53
R4955:Fbn2 UTSW 18 58058383 missense possibly damaging 0.61
R4980:Fbn2 UTSW 18 58010631 missense probably benign 0.05
R4998:Fbn2 UTSW 18 58072631 missense probably damaging 1.00
R5133:Fbn2 UTSW 18 58039340 missense probably damaging 0.99
R5322:Fbn2 UTSW 18 58039315 missense probably benign 0.00
R5414:Fbn2 UTSW 18 58093405 missense probably damaging 0.96
R5538:Fbn2 UTSW 18 58071901 missense probably benign 0.22
R5557:Fbn2 UTSW 18 58115659 missense probably benign 0.00
R5754:Fbn2 UTSW 18 58124311 missense probably benign 0.04
R5769:Fbn2 UTSW 18 58105199 missense probably damaging 1.00
R5790:Fbn2 UTSW 18 58076696 missense probably benign 0.34
R5830:Fbn2 UTSW 18 58114469 missense probably benign 0.01
R5845:Fbn2 UTSW 18 58053768 missense possibly damaging 0.89
R5880:Fbn2 UTSW 18 58023282 nonsense probably null
R5907:Fbn2 UTSW 18 58045337 missense probably damaging 1.00
R5948:Fbn2 UTSW 18 58037049 missense probably damaging 1.00
R5955:Fbn2 UTSW 18 58044256 missense probably damaging 1.00
R5974:Fbn2 UTSW 18 58048920 missense probably damaging 1.00
R6010:Fbn2 UTSW 18 58069524 missense probably benign 0.31
R6024:Fbn2 UTSW 18 58076836 missense probably benign 0.03
R6037:Fbn2 UTSW 18 58044223 missense probably benign 0.05
R6037:Fbn2 UTSW 18 58044223 missense probably benign 0.05
R6315:Fbn2 UTSW 18 58054953 critical splice acceptor site probably null
R6437:Fbn2 UTSW 18 58113363 missense probably damaging 1.00
R6519:Fbn2 UTSW 18 58063575 missense possibly damaging 0.61
R6520:Fbn2 UTSW 18 58102390 missense probably damaging 1.00
R6734:Fbn2 UTSW 18 58035960 missense probably damaging 1.00
R6755:Fbn2 UTSW 18 58113333 missense possibly damaging 0.89
R6789:Fbn2 UTSW 18 58010614 missense probably benign 0.00
R6801:Fbn2 UTSW 18 58113348 missense probably benign 0.04
R6862:Fbn2 UTSW 18 58124321 missense probably benign 0.04
R6900:Fbn2 UTSW 18 58076831 missense probably benign
R6906:Fbn2 UTSW 18 58071819 missense possibly damaging 0.94
R6919:Fbn2 UTSW 18 58124187 intron probably null
R6950:Fbn2 UTSW 18 58035921 missense probably null 0.21
R6985:Fbn2 UTSW 18 58068388 missense probably damaging 1.00
R7056:Fbn2 UTSW 18 58076726 missense probably benign
X0062:Fbn2 UTSW 18 58056213 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCCTATGTCCCAATGCTAT -3'
(R):5'- GCCCCTCCCCTTGGTAAGAT -3'

Sequencing Primer
(F):5'- TTGGACTTCACACACAGGGGTTC -3'
(R):5'- TCCCCTTGGTAAGATCTTCTTTC -3'
Posted On2015-10-08