Incidental Mutation 'R4628:Mcm6'
ID348917
Institutional Source Beutler Lab
Gene Symbol Mcm6
Ensembl Gene ENSMUSG00000026355
Gene Nameminichromosome maintenance complex component 6
SynonymsD1Wsu22e, Mcmd6
MMRRC Submission 041893-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4628 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location128331590-128359664 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128351548 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 167 (D167G)
Ref Sequence ENSEMBL: ENSMUSP00000140308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027601] [ENSMUST00000190495]
Predicted Effect probably benign
Transcript: ENSMUST00000027601
AA Change: D167G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000027601
Gene: ENSMUSG00000026355
AA Change: D167G

DomainStartEndE-ValueType
MCM 119 657 1.43e-270 SMART
PDB:2LE8|A 710 821 1e-47 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000190495
AA Change: D167G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000140308
Gene: ENSMUSG00000026355
AA Change: D167G

DomainStartEndE-ValueType
MCM 119 657 1.43e-270 SMART
PDB:2LE8|A 710 783 3e-29 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by the MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. The MCM complex consisting of this protein and MCM2, 4 and 7 proteins possesses DNA helicase activity, and may act as a DNA unwinding enzyme. The phosphorylation of the complex by CDC2 kinase reduces the helicase activity, suggesting a role in the regulation of DNA replication. Single nucleotide polymorphisms in the intron regions of this gene are associated with differential transcriptional activation of the promoter of the neighboring lactase gene and, thereby, influence lactose intolerance in early adulthood. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit increased micronulei-containing red blood cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik G C 5: 118,259,414 A154P probably damaging Het
Abca7 G T 10: 80,015,188 probably null Het
Abcb4 A G 5: 8,907,399 D176G probably benign Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
AF366264 T A 8: 13,836,625 R489W probably damaging Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd12 T C 17: 65,985,994 T815A probably benign Het
Arid3a T C 10: 79,931,158 S89P possibly damaging Het
Ass1 A T 2: 31,480,988 D63V probably damaging Het
Atxn3 T A 12: 101,923,078 probably benign Het
Bcap29 C T 12: 31,626,807 S88N probably benign Het
Bsn G T 9: 108,113,235 P1773T probably damaging Het
Ccdc141 A G 2: 77,059,680 S423P probably benign Het
Cfap46 A T 7: 139,680,927 L85Q probably damaging Het
Chd8 T C 14: 52,206,915 R438G probably benign Het
Chd9 T A 8: 90,983,463 M289K probably benign Het
Col14a1 T A 15: 55,449,833 Y26* probably null Het
Colec10 A G 15: 54,459,731 T117A possibly damaging Het
Colq C A 14: 31,544,022 G178V probably damaging Het
Defb3 A T 8: 19,295,140 R37S probably benign Het
Duox1 A G 2: 122,346,252 Y1418C probably damaging Het
Engase C T 11: 118,484,905 S33F probably damaging Het
Erich3 A T 3: 154,763,687 T1259S probably damaging Het
Fam98c T C 7: 29,155,268 T49A possibly damaging Het
Fhod3 T A 18: 25,120,129 F1379I possibly damaging Het
Fndc3b T C 3: 27,556,128 I86V probably benign Het
Gm1123 A G 9: 99,014,236 V197A probably damaging Het
Gm4847 A T 1: 166,630,395 V463E probably damaging Het
Gm9772 T C 17: 22,007,207 K32R probably damaging Het
Gm9804 T C 12: 49,401,757 S161P unknown Het
Gpr162 C T 6: 124,861,442 D82N probably benign Het
Grid2ip T C 5: 143,382,875 V650A probably damaging Het
Hs1bp3 T C 12: 8,336,357 V253A probably benign Het
Hsd3b6 T G 3: 98,806,579 K135Q possibly damaging Het
Igfn1 T C 1: 135,959,730 D2532G possibly damaging Het
Iqgap2 A G 13: 95,763,329 Y74H probably benign Het
Itga2 A G 13: 114,877,693 V233A probably benign Het
Kat14 A G 2: 144,404,220 probably benign Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Kera A G 10: 97,609,631 N284S probably benign Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lcmt1 T A 7: 123,410,812 C183* probably null Het
Lcn5 A G 2: 25,658,063 E28G possibly damaging Het
Leo1 A T 9: 75,445,697 D174V probably damaging Het
Llgl1 A T 11: 60,709,985 T636S probably damaging Het
Lrrc8e T A 8: 4,233,981 C69S probably damaging Het
Maml3 A T 3: 51,796,470 probably benign Het
Maz G T 7: 127,025,347 H334N possibly damaging Het
Mrpl24 A C 3: 87,922,129 probably null Het
Myo18a G A 11: 77,824,136 V834M probably damaging Het
Neb T A 2: 52,308,350 R461* probably null Het
Notch4 C A 17: 34,570,185 T486N probably damaging Het
Nphp3 A G 9: 104,003,058 E93G probably damaging Het
Nup188 A G 2: 30,329,346 Y858C probably damaging Het
Olfr339 T A 2: 36,421,857 L153* probably null Het
Olfr45 T A 7: 140,691,378 S158T probably benign Het
Olfr61 C T 7: 140,638,384 R228C probably benign Het
Otud4 T A 8: 79,639,968 D21E possibly damaging Het
Ovgp1 T A 3: 105,980,323 probably null Het
Pdia3 A T 2: 121,414,139 N11I possibly damaging Het
Pex5 T C 6: 124,403,120 D286G possibly damaging Het
Pias3 T C 3: 96,699,820 I133T probably damaging Het
Postn A G 3: 54,372,157 D352G probably damaging Het
Prl7c1 T C 13: 27,778,082 R81G probably benign Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Rtraf T A 14: 19,817,087 N116I probably benign Het
Slc6a12 T A 6: 121,351,992 C50* probably null Het
Srcin1 T A 11: 97,548,926 H126L probably benign Het
Tmtc2 A T 10: 105,303,650 S672T probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ube2c A G 2: 164,772,173 N143S possibly damaging Het
Uroc1 A T 6: 90,355,328 I556F probably damaging Het
Vmn1r124 T A 7: 21,260,377 K81* probably null Het
Vmn1r57 T A 7: 5,220,973 C166S probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r68 A G 7: 85,234,465 V144A probably benign Het
Vmn2r85 C T 10: 130,425,366 M367I probably benign Het
Vwa3a T A 7: 120,793,375 N812K probably benign Het
Wdfy4 A T 14: 33,102,558 N1301K probably damaging Het
Zfhx4 G A 3: 5,403,476 R2898H probably damaging Het
Other mutations in Mcm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Mcm6 APN 1 128344383 missense probably damaging 1.00
IGL01420:Mcm6 APN 1 128345875 missense probably damaging 1.00
IGL01746:Mcm6 APN 1 128353524 nonsense probably null
IGL02256:Mcm6 APN 1 128335728 critical splice donor site probably null
IGL02624:Mcm6 APN 1 128349448 missense possibly damaging 0.91
IGL02732:Mcm6 APN 1 128359490 missense probably benign 0.16
IGL02750:Mcm6 APN 1 128343472 missense probably damaging 1.00
IGL02926:Mcm6 APN 1 128339382 missense probably damaging 1.00
IGL03189:Mcm6 APN 1 128344302 missense probably damaging 1.00
IGL03238:Mcm6 APN 1 128355520 missense probably benign 0.13
IGL03397:Mcm6 APN 1 128344302 missense probably damaging 1.00
R0453:Mcm6 UTSW 1 128333555 missense probably benign 0.00
R0501:Mcm6 UTSW 1 128355636 missense probably benign 0.03
R0885:Mcm6 UTSW 1 128348933 missense probably benign 0.00
R1013:Mcm6 UTSW 1 128349041 missense probably benign
R1319:Mcm6 UTSW 1 128349052 missense probably benign
R1396:Mcm6 UTSW 1 128351476 missense probably damaging 1.00
R1656:Mcm6 UTSW 1 128349418 missense possibly damaging 0.90
R1891:Mcm6 UTSW 1 128335810 missense probably damaging 1.00
R1950:Mcm6 UTSW 1 128345989 missense probably benign 0.35
R3411:Mcm6 UTSW 1 128351585 missense probably benign 0.35
R4564:Mcm6 UTSW 1 128343459 missense probably damaging 1.00
R4626:Mcm6 UTSW 1 128351548 missense probably benign 0.01
R4627:Mcm6 UTSW 1 128351548 missense probably benign 0.01
R4916:Mcm6 UTSW 1 128348977 missense probably damaging 1.00
R4965:Mcm6 UTSW 1 128359486 missense probably damaging 1.00
R4967:Mcm6 UTSW 1 128335849 missense probably damaging 1.00
R5016:Mcm6 UTSW 1 128343427 missense probably damaging 1.00
R5204:Mcm6 UTSW 1 128333638 missense probably benign 0.01
R5229:Mcm6 UTSW 1 128333584 missense possibly damaging 0.82
R5607:Mcm6 UTSW 1 128355589 missense probably damaging 1.00
R5811:Mcm6 UTSW 1 128335728 critical splice donor site probably benign
R5816:Mcm6 UTSW 1 128348455 missense probably benign 0.01
Z1088:Mcm6 UTSW 1 128344298 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACCTTCTGGCCTCTGTGG -3'
(R):5'- AATCCCTGGAACTGAAGTGGG -3'

Sequencing Primer
(F):5'- GTGGGCACTACATTCCTTAAAAACTG -3'
(R):5'- CCCTGGAACTGAAGTGGGGAAAG -3'
Posted On2015-10-08