Mutagenetix > Incidental Mutations

Incidental Mutation 'R4628:Mcm6'

348917

Institutional Source

Beutler Lab

Gene Symbol

Mcm6

Ensembl Gene

ENSMUSG00000026355

Gene Name

minichromosome maintenance complex component 6

Synonyms

D1Wsu22e, Mcmd6

MMRRC Submission

041893-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4628 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

128331590-128359664 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 128351548 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 167 (D167G)

Ref Sequence

ENSEMBL: ENSMUSP00000140308 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027601] [ENSMUST00000190495]

Predicted Effect

probably benign
Transcript: ENSMUST00000027601
AA Change: D167G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000027601
Gene: ENSMUSG00000026355
AA Change: D167G

Domain	Start	End	E-Value	Type
MCM	119	657	1.43e-270	SMART
PDB:2LE8\|A	710	821	1e-47	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000190495
AA Change: D167G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000140308
Gene: ENSMUSG00000026355
AA Change: D167G

Domain	Start	End	E-Value	Type
MCM	119	657	1.43e-270	SMART
PDB:2LE8\|A	710	783	3e-29	PDB

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by the MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. The MCM complex consisting of this protein and MCM2, 4 and 7 proteins possesses DNA helicase activity, and may act as a DNA unwinding enzyme. The phosphorylation of the complex by CDC2 kinase reduces the helicase activity, suggesting a role in the regulation of DNA replication. Single nucleotide polymorphisms in the intron regions of this gene are associated with differential transcriptional activation of the promoter of the neighboring lactase gene and, thereby, influence lactose intolerance in early adulthood. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit increased micronulei-containing red blood cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410131K14Rik	G	C	5: 118,259,414	A154P	probably damaging	Het
Abca7	G	T	10: 80,015,188		probably null	Het
Abcb4	A	G	5: 8,907,399	D176G	probably benign	Het
Adamts18	C	T	8: 113,773,168	W371*	probably null	Het
AF366264	T	A	8: 13,836,625	R489W	probably damaging	Het
Akr1c13	G	T	13: 4,197,870	V214F	probably damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Ankrd12	T	C	17: 65,985,994	T815A	probably benign	Het
Arid3a	T	C	10: 79,931,158	S89P	possibly damaging	Het
Ass1	A	T	2: 31,480,988	D63V	probably damaging	Het
Atxn3	T	A	12: 101,923,078		probably benign	Het
Bcap29	C	T	12: 31,626,807	S88N	probably benign	Het
Bsn	G	T	9: 108,113,235	P1773T	probably damaging	Het
Ccdc141	A	G	2: 77,059,680	S423P	probably benign	Het
Cfap46	A	T	7: 139,680,927	L85Q	probably damaging	Het
Chd8	T	C	14: 52,206,915	R438G	probably benign	Het
Chd9	T	A	8: 90,983,463	M289K	probably benign	Het
Col14a1	T	A	15: 55,449,833	Y26*	probably null	Het
Colec10	A	G	15: 54,459,731	T117A	possibly damaging	Het
Colq	C	A	14: 31,544,022	G178V	probably damaging	Het
Defb3	A	T	8: 19,295,140	R37S	probably benign	Het
Duox1	A	G	2: 122,346,252	Y1418C	probably damaging	Het
Engase	C	T	11: 118,484,905	S33F	probably damaging	Het
Erich3	A	T	3: 154,763,687	T1259S	probably damaging	Het
Fam98c	T	C	7: 29,155,268	T49A	possibly damaging	Het
Fhod3	T	A	18: 25,120,129	F1379I	possibly damaging	Het
Fndc3b	T	C	3: 27,556,128	I86V	probably benign	Het
Gm1123	A	G	9: 99,014,236	V197A	probably damaging	Het
Gm4847	A	T	1: 166,630,395	V463E	probably damaging	Het
Gm9772	T	C	17: 22,007,207	K32R	probably damaging	Het
Gm9804	T	C	12: 49,401,757	S161P	unknown	Het
Gpr162	C	T	6: 124,861,442	D82N	probably benign	Het
Grid2ip	T	C	5: 143,382,875	V650A	probably damaging	Het
Hs1bp3	T	C	12: 8,336,357	V253A	probably benign	Het
Hsd3b6	T	G	3: 98,806,579	K135Q	possibly damaging	Het
Igfn1	T	C	1: 135,959,730	D2532G	possibly damaging	Het
Iqgap2	A	G	13: 95,763,329	Y74H	probably benign	Het
Itga2	A	G	13: 114,877,693	V233A	probably benign	Het
Kat14	A	G	2: 144,404,220		probably benign	Het
Kctd21	A	G	7: 97,347,575	D85G	probably damaging	Het
Kera	A	G	10: 97,609,631	N284S	probably benign	Het
Krt1	C	T	15: 101,846,187	G543S	unknown	Het
Lcmt1	T	A	7: 123,410,812	C183*	probably null	Het
Lcn5	A	G	2: 25,658,063	E28G	possibly damaging	Het
Leo1	A	T	9: 75,445,697	D174V	probably damaging	Het
Llgl1	A	T	11: 60,709,985	T636S	probably damaging	Het
Lrrc8e	T	A	8: 4,233,981	C69S	probably damaging	Het
Maml3	A	T	3: 51,796,470		probably benign	Het
Maz	G	T	7: 127,025,347	H334N	possibly damaging	Het
Mrpl24	A	C	3: 87,922,129		probably null	Het
Myo18a	G	A	11: 77,824,136	V834M	probably damaging	Het
Neb	T	A	2: 52,308,350	R461*	probably null	Het
Notch4	C	A	17: 34,570,185	T486N	probably damaging	Het
Nphp3	A	G	9: 104,003,058	E93G	probably damaging	Het
Nup188	A	G	2: 30,329,346	Y858C	probably damaging	Het
Olfr339	T	A	2: 36,421,857	L153*	probably null	Het
Olfr45	T	A	7: 140,691,378	S158T	probably benign	Het
Olfr61	C	T	7: 140,638,384	R228C	probably benign	Het
Otud4	T	A	8: 79,639,968	D21E	possibly damaging	Het
Ovgp1	T	A	3: 105,980,323		probably null	Het
Pdia3	A	T	2: 121,414,139	N11I	possibly damaging	Het
Pex5	T	C	6: 124,403,120	D286G	possibly damaging	Het
Pias3	T	C	3: 96,699,820	I133T	probably damaging	Het
Postn	A	G	3: 54,372,157	D352G	probably damaging	Het
Prl7c1	T	C	13: 27,778,082	R81G	probably benign	Het
Rmi1	A	G	13: 58,409,136	R400G	probably benign	Het
Rtraf	T	A	14: 19,817,087	N116I	probably benign	Het
Slc6a12	T	A	6: 121,351,992	C50*	probably null	Het
Srcin1	T	A	11: 97,548,926	H126L	probably benign	Het
Tmtc2	A	T	10: 105,303,650	S672T	probably benign	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Ube2c	A	G	2: 164,772,173	N143S	possibly damaging	Het
Uroc1	A	T	6: 90,355,328	I556F	probably damaging	Het
Vmn1r124	T	A	7: 21,260,377	K81*	probably null	Het
Vmn1r57	T	A	7: 5,220,973	C166S	probably damaging	Het
Vmn2r114	ATTT	ATT	17: 23,290,932		probably null	Het
Vmn2r68	A	G	7: 85,234,465	V144A	probably benign	Het
Vmn2r85	C	T	10: 130,425,366	M367I	probably benign	Het
Vwa3a	T	A	7: 120,793,375	N812K	probably benign	Het
Wdfy4	A	T	14: 33,102,558	N1301K	probably damaging	Het
Zfhx4	G	A	3: 5,403,476	R2898H	probably damaging	Het

Other mutations in Mcm6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00518:Mcm6	APN	1	128344383	missense	probably damaging	1.00
IGL01420:Mcm6	APN	1	128345875	missense	probably damaging	1.00
IGL01746:Mcm6	APN	1	128353524	nonsense	probably null
IGL02256:Mcm6	APN	1	128335728	critical splice donor site	probably null
IGL02624:Mcm6	APN	1	128349448	missense	possibly damaging	0.91
IGL02732:Mcm6	APN	1	128359490	missense	probably benign	0.16
IGL02750:Mcm6	APN	1	128343472	missense	probably damaging	1.00
IGL02926:Mcm6	APN	1	128339382	missense	probably damaging	1.00
IGL03189:Mcm6	APN	1	128344302	missense	probably damaging	1.00
IGL03238:Mcm6	APN	1	128355520	missense	probably benign	0.13
IGL03397:Mcm6	APN	1	128344302	missense	probably damaging	1.00
R0453:Mcm6	UTSW	1	128333555	missense	probably benign	0.00
R0501:Mcm6	UTSW	1	128355636	missense	probably benign	0.03
R0885:Mcm6	UTSW	1	128348933	missense	probably benign	0.00
R1013:Mcm6	UTSW	1	128349041	missense	probably benign
R1319:Mcm6	UTSW	1	128349052	missense	probably benign
R1396:Mcm6	UTSW	1	128351476	missense	probably damaging	1.00
R1656:Mcm6	UTSW	1	128349418	missense	possibly damaging	0.90
R1891:Mcm6	UTSW	1	128335810	missense	probably damaging	1.00
R1950:Mcm6	UTSW	1	128345989	missense	probably benign	0.35
R3411:Mcm6	UTSW	1	128351585	missense	probably benign	0.35
R4564:Mcm6	UTSW	1	128343459	missense	probably damaging	1.00
R4626:Mcm6	UTSW	1	128351548	missense	probably benign	0.01
R4627:Mcm6	UTSW	1	128351548	missense	probably benign	0.01
R4916:Mcm6	UTSW	1	128348977	missense	probably damaging	1.00
R4965:Mcm6	UTSW	1	128359486	missense	probably damaging	1.00
R4967:Mcm6	UTSW	1	128335849	missense	probably damaging	1.00
R5016:Mcm6	UTSW	1	128343427	missense	probably damaging	1.00
R5204:Mcm6	UTSW	1	128333638	missense	probably benign	0.01
R5229:Mcm6	UTSW	1	128333584	missense	possibly damaging	0.82
R5607:Mcm6	UTSW	1	128355589	missense	probably damaging	1.00
R5811:Mcm6	UTSW	1	128335728	critical splice donor site	probably benign
R5816:Mcm6	UTSW	1	128348455	missense	probably benign	0.01
Z1088:Mcm6	UTSW	1	128344298	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATACCTTCTGGCCTCTGTGG -3'
(R):5'- AATCCCTGGAACTGAAGTGGG -3'

Sequencing Primer
(F):5'- GTGGGCACTACATTCCTTAAAAACTG -3'
(R):5'- CCCTGGAACTGAAGTGGGGAAAG -3'

Posted On

2015-10-08