Incidental Mutation 'R4628:Duox1'
ID348928
Institutional Source Beutler Lab
Gene Symbol Duox1
Ensembl Gene ENSMUSG00000033268
Gene Namedual oxidase 1
SynonymsTHOX1, LNOX1, 9930101G15Rik, NOXEF1
MMRRC Submission 041893-MU
Accession Numbers

Genbank: NM_001099297; MGI: 2139422

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4628 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location122315672-122347972 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122346252 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1418 (Y1418C)
Ref Sequence ENSEMBL: ENSMUSP00000097060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048635] [ENSMUST00000099461] [ENSMUST00000110530] [ENSMUST00000110531] [ENSMUST00000110532] [ENSMUST00000121237] [ENSMUST00000125826] [ENSMUST00000139819]
Predicted Effect probably benign
Transcript: ENSMUST00000048635
SMART Domains Protein: ENSMUSP00000045135
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 48 67 N/A INTRINSIC
SH2 136 220 9.16e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099461
AA Change: Y1418C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097060
Gene: ENSMUSG00000033268
AA Change: Y1418C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:An_peroxidase 29 557 2.1e-134 PFAM
transmembrane domain 594 616 N/A INTRINSIC
EFh 819 847 1.82e-4 SMART
EFh 855 883 3.45e-5 SMART
transmembrane domain 1044 1066 N/A INTRINSIC
Pfam:Ferric_reduct 1087 1236 5.3e-21 PFAM
Pfam:FAD_binding_8 1272 1374 8.5e-21 PFAM
Pfam:NAD_binding_6 1380 1534 3.5e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110530
SMART Domains Protein: ENSMUSP00000106159
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 42 61 N/A INTRINSIC
SH2 130 214 9.16e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110531
SMART Domains Protein: ENSMUSP00000106160
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 48 67 N/A INTRINSIC
SH2 136 220 9.16e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110532
SMART Domains Protein: ENSMUSP00000106161
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 19 38 N/A INTRINSIC
low complexity region 45 61 N/A INTRINSIC
low complexity region 77 87 N/A INTRINSIC
low complexity region 146 165 N/A INTRINSIC
Blast:SH2 225 278 2e-22 BLAST
SCOP:d1ayaa_ 237 291 1e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121237
SMART Domains Protein: ENSMUSP00000113923
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 42 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125826
SMART Domains Protein: ENSMUSP00000117099
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 14 56 N/A INTRINSIC
low complexity region 76 105 N/A INTRINSIC
low complexity region 129 148 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
low complexity region 187 197 N/A INTRINSIC
low complexity region 256 275 N/A INTRINSIC
SH2 344 428 9.16e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135848
Predicted Effect probably benign
Transcript: ENSMUST00000139819
SMART Domains Protein: ENSMUSP00000119980
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 14 24 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 149 163 N/A INTRINSIC
SH2 218 302 9.16e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143484
SMART Domains Protein: ENSMUSP00000120732
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 14 33 N/A INTRINSIC
SH2 71 155 3.19e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151130
SMART Domains Protein: ENSMUSP00000114524
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 6 48 N/A INTRINSIC
low complexity region 68 97 N/A INTRINSIC
low complexity region 121 140 N/A INTRINSIC
low complexity region 147 163 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
low complexity region 248 267 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein and a member of the NADPH oxidase family. The synthesis of thyroid hormone is catalyzed by a protein complex located at the apical membrane of thyroid follicular cells. This complex contains an iodide transporter, thyroperoxidase, and a peroxide generating system that includes proteins encoded by this gene and the similar DUOX2 gene. This protein is known as dual oxidase because it has both a peroxidase homology domain and a gp91phox domain. This protein generates hydrogen peroxide and thereby plays a role in the activity of thyroid peroxidase, lactoperoxidase, and in lactoperoxidase-mediated antimicrobial defense at mucosal surfaces. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI

All alleles(6) : Targeted, other(3) Gene trapped(3)

 

Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik G C 5: 118,259,414 A154P probably damaging Het
Abca7 G T 10: 80,015,188 probably null Het
Abcb4 A G 5: 8,907,399 D176G probably benign Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
AF366264 T A 8: 13,836,625 R489W probably damaging Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd12 T C 17: 65,985,994 T815A probably benign Het
Arid3a T C 10: 79,931,158 S89P possibly damaging Het
Ass1 A T 2: 31,480,988 D63V probably damaging Het
Atxn3 T A 12: 101,923,078 probably benign Het
Bcap29 C T 12: 31,626,807 S88N probably benign Het
Bsn G T 9: 108,113,235 P1773T probably damaging Het
Ccdc141 A G 2: 77,059,680 S423P probably benign Het
Cfap46 A T 7: 139,680,927 L85Q probably damaging Het
Chd8 T C 14: 52,206,915 R438G probably benign Het
Chd9 T A 8: 90,983,463 M289K probably benign Het
Col14a1 T A 15: 55,449,833 Y26* probably null Het
Colec10 A G 15: 54,459,731 T117A possibly damaging Het
Colq C A 14: 31,544,022 G178V probably damaging Het
Defb3 A T 8: 19,295,140 R37S probably benign Het
Engase C T 11: 118,484,905 S33F probably damaging Het
Erich3 A T 3: 154,763,687 T1259S probably damaging Het
Fam98c T C 7: 29,155,268 T49A possibly damaging Het
Fhod3 T A 18: 25,120,129 F1379I possibly damaging Het
Fndc3b T C 3: 27,556,128 I86V probably benign Het
Gm1123 A G 9: 99,014,236 V197A probably damaging Het
Gm4847 A T 1: 166,630,395 V463E probably damaging Het
Gm9772 T C 17: 22,007,207 K32R probably damaging Het
Gm9804 T C 12: 49,401,757 S161P unknown Het
Gpr162 C T 6: 124,861,442 D82N probably benign Het
Grid2ip T C 5: 143,382,875 V650A probably damaging Het
Hs1bp3 T C 12: 8,336,357 V253A probably benign Het
Hsd3b6 T G 3: 98,806,579 K135Q possibly damaging Het
Igfn1 T C 1: 135,959,730 D2532G possibly damaging Het
Iqgap2 A G 13: 95,763,329 Y74H probably benign Het
Itga2 A G 13: 114,877,693 V233A probably benign Het
Kat14 A G 2: 144,404,220 probably benign Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Kera A G 10: 97,609,631 N284S probably benign Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lcmt1 T A 7: 123,410,812 C183* probably null Het
Lcn5 A G 2: 25,658,063 E28G possibly damaging Het
Leo1 A T 9: 75,445,697 D174V probably damaging Het
Llgl1 A T 11: 60,709,985 T636S probably damaging Het
Lrrc8e T A 8: 4,233,981 C69S probably damaging Het
Maml3 A T 3: 51,796,470 probably benign Het
Maz G T 7: 127,025,347 H334N possibly damaging Het
Mcm6 T C 1: 128,351,548 D167G probably benign Het
Mrpl24 A C 3: 87,922,129 probably null Het
Myo18a G A 11: 77,824,136 V834M probably damaging Het
Neb T A 2: 52,308,350 R461* probably null Het
Notch4 C A 17: 34,570,185 T486N probably damaging Het
Nphp3 A G 9: 104,003,058 E93G probably damaging Het
Nup188 A G 2: 30,329,346 Y858C probably damaging Het
Olfr339 T A 2: 36,421,857 L153* probably null Het
Olfr45 T A 7: 140,691,378 S158T probably benign Het
Olfr61 C T 7: 140,638,384 R228C probably benign Het
Otud4 T A 8: 79,639,968 D21E possibly damaging Het
Ovgp1 T A 3: 105,980,323 probably null Het
Pdia3 A T 2: 121,414,139 N11I possibly damaging Het
Pex5 T C 6: 124,403,120 D286G possibly damaging Het
Pias3 T C 3: 96,699,820 I133T probably damaging Het
Postn A G 3: 54,372,157 D352G probably damaging Het
Prl7c1 T C 13: 27,778,082 R81G probably benign Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Rtraf T A 14: 19,817,087 N116I probably benign Het
Slc6a12 T A 6: 121,351,992 C50* probably null Het
Srcin1 T A 11: 97,548,926 H126L probably benign Het
Tmtc2 A T 10: 105,303,650 S672T probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ube2c A G 2: 164,772,173 N143S possibly damaging Het
Uroc1 A T 6: 90,355,328 I556F probably damaging Het
Vmn1r124 T A 7: 21,260,377 K81* probably null Het
Vmn1r57 T A 7: 5,220,973 C166S probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r68 A G 7: 85,234,465 V144A probably benign Het
Vmn2r85 C T 10: 130,425,366 M367I probably benign Het
Vwa3a T A 7: 120,793,375 N812K probably benign Het
Wdfy4 A T 14: 33,102,558 N1301K probably damaging Het
Zfhx4 G A 3: 5,403,476 R2898H probably damaging Het
Other mutations in Duox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Duox1 APN 2 122333141 missense possibly damaging 0.55
IGL00956:Duox1 APN 2 122323306 missense probably benign 0.42
IGL01413:Duox1 APN 2 122320710 missense probably benign 0.03
IGL01444:Duox1 APN 2 122340090 missense probably damaging 0.98
IGL01633:Duox1 APN 2 122333798 missense probably benign 0.00
IGL01814:Duox1 APN 2 122346272 missense probably damaging 0.99
IGL01868:Duox1 APN 2 122338407 missense probably benign
IGL02096:Duox1 APN 2 122344174 missense probably damaging 0.99
IGL02126:Duox1 APN 2 122346336 missense probably benign 0.21
IGL02342:Duox1 APN 2 122347312 missense probably damaging 1.00
IGL02687:Duox1 APN 2 122336415 missense probably damaging 1.00
IGL02708:Duox1 APN 2 122326017 missense possibly damaging 0.81
IGL02935:Duox1 APN 2 122324519 missense possibly damaging 0.56
D4043:Duox1 UTSW 2 122344795 missense probably benign
R0047:Duox1 UTSW 2 122346641 unclassified probably benign
R0047:Duox1 UTSW 2 122346641 unclassified probably benign
R0241:Duox1 UTSW 2 122333397 splice site probably benign
R0479:Duox1 UTSW 2 122346380 missense probably damaging 1.00
R0834:Duox1 UTSW 2 122346501 missense probably damaging 1.00
R1105:Duox1 UTSW 2 122337702 missense probably damaging 0.97
R1205:Duox1 UTSW 2 122327925 nonsense probably null
R1281:Duox1 UTSW 2 122327088 missense probably damaging 1.00
R1302:Duox1 UTSW 2 122347279 missense probably benign 0.24
R1532:Duox1 UTSW 2 122344723 missense probably damaging 1.00
R1706:Duox1 UTSW 2 122319472 missense probably benign 0.01
R1719:Duox1 UTSW 2 122338644 missense possibly damaging 0.93
R1753:Duox1 UTSW 2 122333429 missense probably damaging 1.00
R1827:Duox1 UTSW 2 122347380 nonsense probably null
R1828:Duox1 UTSW 2 122347380 nonsense probably null
R1940:Duox1 UTSW 2 122325984 missense probably benign 0.06
R1944:Duox1 UTSW 2 122346520 missense probably damaging 0.99
R2069:Duox1 UTSW 2 122333062 missense probably benign
R2113:Duox1 UTSW 2 122337254 missense probably benign
R2202:Duox1 UTSW 2 122344713 missense probably benign 0.19
R2314:Duox1 UTSW 2 122333730 nonsense probably null
R2507:Duox1 UTSW 2 122333138 missense probably benign 0.34
R2508:Duox1 UTSW 2 122333138 missense probably benign 0.34
R3177:Duox1 UTSW 2 122340116 missense probably damaging 1.00
R3277:Duox1 UTSW 2 122340116 missense probably damaging 1.00
R4124:Duox1 UTSW 2 122337421 missense probably damaging 1.00
R4271:Duox1 UTSW 2 122324375 missense probably damaging 0.96
R4411:Duox1 UTSW 2 122337634 missense probably benign 0.30
R4419:Duox1 UTSW 2 122327126 missense probably benign
R4420:Duox1 UTSW 2 122327126 missense probably benign
R4578:Duox1 UTSW 2 122333777 missense probably benign 0.15
R4665:Duox1 UTSW 2 122319475 missense probably benign 0.00
R4666:Duox1 UTSW 2 122319475 missense probably benign 0.00
R4730:Duox1 UTSW 2 122333831 missense probably damaging 1.00
R4767:Duox1 UTSW 2 122333441 missense possibly damaging 0.79
R4857:Duox1 UTSW 2 122315731 missense probably benign 0.05
R4904:Duox1 UTSW 2 122320864 missense probably damaging 1.00
R5032:Duox1 UTSW 2 122337317 missense probably benign
R5201:Duox1 UTSW 2 122327922 missense probably benign
R5474:Duox1 UTSW 2 122346625 missense probably benign 0.02
R5835:Duox1 UTSW 2 122327860 missense probably benign 0.00
R5939:Duox1 UTSW 2 122346351 missense probably damaging 1.00
R5941:Duox1 UTSW 2 122344156 missense probably damaging 0.97
R5943:Duox1 UTSW 2 122333435 missense probably benign 0.00
R5970:Duox1 UTSW 2 122340201 missense probably damaging 1.00
R6023:Duox1 UTSW 2 122337684 missense probably benign 0.19
R6050:Duox1 UTSW 2 122319475 missense probably benign 0.00
R6064:Duox1 UTSW 2 122320762 missense probably benign 0.00
R6093:Duox1 UTSW 2 122347274 missense probably benign 0.01
R6188:Duox1 UTSW 2 122319794 missense probably benign 0.00
R6246:Duox1 UTSW 2 122327174 missense probably damaging 1.00
R6259:Duox1 UTSW 2 122344783 missense probably benign 0.00
R6290:Duox1 UTSW 2 122333807 missense possibly damaging 0.92
R6300:Duox1 UTSW 2 122337700 missense probably damaging 0.99
R6341:Duox1 UTSW 2 122337721 missense probably damaging 0.98
R6498:Duox1 UTSW 2 122319607 missense probably damaging 1.00
R6885:Duox1 UTSW 2 122324584 intron probably null
Predicted Primers PCR Primer
(F):5'- CTGTCCAAGGGCAAAATACATC -3'
(R):5'- GCCATTGCTAGGAACAACCC -3'

Sequencing Primer
(F):5'- ATACATCTCTGTATTGAGGCTGGCC -3'
(R):5'- TTGCTAGGAACAACCCTTGGC -3'
Posted On2015-10-08