Incidental Mutation 'R4628:Ube2c'
ID348930
Institutional Source Beutler Lab
Gene Symbol Ube2c
Ensembl Gene ENSMUSG00000001403
Gene Nameubiquitin-conjugating enzyme E2C
Synonyms1110015A16Rik, D2Ertd695e
MMRRC Submission 041893-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R4628 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location164769898-164778822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 164772173 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 143 (N143S)
Ref Sequence ENSEMBL: ENSMUSP00000001439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001439] [ENSMUST00000017443] [ENSMUST00000088248] [ENSMUST00000103095]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001439
AA Change: N143S

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000001439
Gene: ENSMUSG00000001403
AA Change: N143S

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
UBCc 33 170 8.8e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000017443
SMART Domains Protein: ENSMUSP00000017443
Gene: ENSMUSG00000017299

DomainStartEndE-ValueType
low complexity region 10 30 N/A INTRINSIC
Blast:UBCc 91 157 4e-16 BLAST
low complexity region 158 172 N/A INTRINSIC
Blast:UBCc 248 287 1e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000088248
AA Change: N143S

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000085581
Gene: ENSMUSG00000001403
AA Change: N143S

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
UBCc 33 175 1.88e-64 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103095
SMART Domains Protein: ENSMUSP00000099384
Gene: ENSMUSG00000017300

DomainStartEndE-ValueType
EFh 19 47 2.44e-5 SMART
EFh 55 83 8.31e-8 SMART
EFh 95 123 2.01e-6 SMART
EFh 131 159 8.06e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146846
Meta Mutation Damage Score 0.188 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, ubiquitin-conjugating enzymes, and ubiquitin-protein ligases. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein is required for the destruction of mitotic cyclins and for cell cycle progression, and may be involved in cancer progression. Multiple transcript variants encoding different isoforms have been found for this gene. Pseudogenes of this gene have been defined on chromosomes 4, 14, 15, 18, and 19. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik G C 5: 118,259,414 A154P probably damaging Het
Abca7 G T 10: 80,015,188 probably null Het
Abcb4 A G 5: 8,907,399 D176G probably benign Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
AF366264 T A 8: 13,836,625 R489W probably damaging Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd12 T C 17: 65,985,994 T815A probably benign Het
Arid3a T C 10: 79,931,158 S89P possibly damaging Het
Ass1 A T 2: 31,480,988 D63V probably damaging Het
Atxn3 T A 12: 101,923,078 probably benign Het
Bcap29 C T 12: 31,626,807 S88N probably benign Het
Bsn G T 9: 108,113,235 P1773T probably damaging Het
Ccdc141 A G 2: 77,059,680 S423P probably benign Het
Cfap46 A T 7: 139,680,927 L85Q probably damaging Het
Chd8 T C 14: 52,206,915 R438G probably benign Het
Chd9 T A 8: 90,983,463 M289K probably benign Het
Col14a1 T A 15: 55,449,833 Y26* probably null Het
Colec10 A G 15: 54,459,731 T117A possibly damaging Het
Colq C A 14: 31,544,022 G178V probably damaging Het
Defb3 A T 8: 19,295,140 R37S probably benign Het
Duox1 A G 2: 122,346,252 Y1418C probably damaging Het
Engase C T 11: 118,484,905 S33F probably damaging Het
Erich3 A T 3: 154,763,687 T1259S probably damaging Het
Fam98c T C 7: 29,155,268 T49A possibly damaging Het
Fhod3 T A 18: 25,120,129 F1379I possibly damaging Het
Fndc3b T C 3: 27,556,128 I86V probably benign Het
Gm1123 A G 9: 99,014,236 V197A probably damaging Het
Gm4847 A T 1: 166,630,395 V463E probably damaging Het
Gm9772 T C 17: 22,007,207 K32R probably damaging Het
Gm9804 T C 12: 49,401,757 S161P unknown Het
Gpr162 C T 6: 124,861,442 D82N probably benign Het
Grid2ip T C 5: 143,382,875 V650A probably damaging Het
Hs1bp3 T C 12: 8,336,357 V253A probably benign Het
Hsd3b6 T G 3: 98,806,579 K135Q possibly damaging Het
Igfn1 T C 1: 135,959,730 D2532G possibly damaging Het
Iqgap2 A G 13: 95,763,329 Y74H probably benign Het
Itga2 A G 13: 114,877,693 V233A probably benign Het
Kat14 A G 2: 144,404,220 probably benign Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Kera A G 10: 97,609,631 N284S probably benign Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lcmt1 T A 7: 123,410,812 C183* probably null Het
Lcn5 A G 2: 25,658,063 E28G possibly damaging Het
Leo1 A T 9: 75,445,697 D174V probably damaging Het
Llgl1 A T 11: 60,709,985 T636S probably damaging Het
Lrrc8e T A 8: 4,233,981 C69S probably damaging Het
Maml3 A T 3: 51,796,470 probably benign Het
Maz G T 7: 127,025,347 H334N possibly damaging Het
Mcm6 T C 1: 128,351,548 D167G probably benign Het
Mrpl24 A C 3: 87,922,129 probably null Het
Myo18a G A 11: 77,824,136 V834M probably damaging Het
Neb T A 2: 52,308,350 R461* probably null Het
Notch4 C A 17: 34,570,185 T486N probably damaging Het
Nphp3 A G 9: 104,003,058 E93G probably damaging Het
Nup188 A G 2: 30,329,346 Y858C probably damaging Het
Olfr339 T A 2: 36,421,857 L153* probably null Het
Olfr45 T A 7: 140,691,378 S158T probably benign Het
Olfr61 C T 7: 140,638,384 R228C probably benign Het
Otud4 T A 8: 79,639,968 D21E possibly damaging Het
Ovgp1 T A 3: 105,980,323 probably null Het
Pdia3 A T 2: 121,414,139 N11I possibly damaging Het
Pex5 T C 6: 124,403,120 D286G possibly damaging Het
Pias3 T C 3: 96,699,820 I133T probably damaging Het
Postn A G 3: 54,372,157 D352G probably damaging Het
Prl7c1 T C 13: 27,778,082 R81G probably benign Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Rtraf T A 14: 19,817,087 N116I probably benign Het
Slc6a12 T A 6: 121,351,992 C50* probably null Het
Srcin1 T A 11: 97,548,926 H126L probably benign Het
Tmtc2 A T 10: 105,303,650 S672T probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Uroc1 A T 6: 90,355,328 I556F probably damaging Het
Vmn1r124 T A 7: 21,260,377 K81* probably null Het
Vmn1r57 T A 7: 5,220,973 C166S probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r68 A G 7: 85,234,465 V144A probably benign Het
Vmn2r85 C T 10: 130,425,366 M367I probably benign Het
Vwa3a T A 7: 120,793,375 N812K probably benign Het
Wdfy4 A T 14: 33,102,558 N1301K probably damaging Het
Zfhx4 G A 3: 5,403,476 R2898H probably damaging Het
Other mutations in Ube2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Ube2c APN 2 164771293 missense probably benign 0.00
IGL01619:Ube2c APN 2 164771312 missense probably damaging 1.00
R1726:Ube2c UTSW 2 164771317 missense probably damaging 1.00
R1748:Ube2c UTSW 2 164771321 missense probably damaging 1.00
R1854:Ube2c UTSW 2 164771362 missense probably damaging 0.99
R1864:Ube2c UTSW 2 164770023 missense probably benign 0.13
R4624:Ube2c UTSW 2 164772173 missense possibly damaging 0.73
R4627:Ube2c UTSW 2 164772173 missense possibly damaging 0.73
R4629:Ube2c UTSW 2 164772173 missense possibly damaging 0.73
R4810:Ube2c UTSW 2 164772562 makesense probably null
R5294:Ube2c UTSW 2 164777190 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTGGTCTGCACTATATGATGTC -3'
(R):5'- TGGTGGTTTCCAGAGTCCAG -3'

Sequencing Primer
(F):5'- GTCTGCACTATATGATGTCAGGAC -3'
(R):5'- TTTCCAGAGTCCAGGGAAGGATC -3'
Posted On2015-10-08