Incidental Mutation 'R4628:Fndc3b'
ID348932
Institutional Source Beutler Lab
Gene Symbol Fndc3b
Ensembl Gene ENSMUSG00000039286
Gene Namefibronectin type III domain containing 3B
Synonymsfad104, 1600019O04Rik
MMRRC Submission 041893-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4628 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location27416162-27711307 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27556128 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 86 (I86V)
Ref Sequence ENSEMBL: ENSMUSP00000141620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046157] [ENSMUST00000193779] [ENSMUST00000195008]
Predicted Effect probably benign
Transcript: ENSMUST00000046157
AA Change: I86V

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000041495
Gene: ENSMUSG00000039286
AA Change: I86V

DomainStartEndE-ValueType
low complexity region 119 132 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
low complexity region 224 246 N/A INTRINSIC
FN3 279 368 6.29e-8 SMART
FN3 382 463 8.31e-8 SMART
FN3 478 560 3.15e-8 SMART
FN3 575 659 4.28e-10 SMART
FN3 674 755 2.14e-10 SMART
FN3 770 849 1.98e-5 SMART
FN3 872 947 1.31e-5 SMART
FN3 961 1042 2.31e-6 SMART
FN3 1057 1137 1.2e-4 SMART
low complexity region 1165 1176 N/A INTRINSIC
transmembrane domain 1182 1204 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191684
Predicted Effect probably benign
Transcript: ENSMUST00000193779
SMART Domains Protein: ENSMUSP00000141888
Gene: ENSMUSG00000039286

DomainStartEndE-ValueType
PDB:1WK0|A 67 117 2e-6 PDB
Blast:FN3 75 119 2e-25 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000195008
AA Change: I86V

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000141620
Gene: ENSMUSG00000039286
AA Change: I86V

DomainStartEndE-ValueType
low complexity region 119 132 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
low complexity region 224 246 N/A INTRINSIC
FN3 279 368 6.29e-8 SMART
FN3 382 463 8.31e-8 SMART
FN3 478 560 3.15e-8 SMART
FN3 575 659 4.28e-10 SMART
FN3 674 755 2.14e-10 SMART
FN3 770 849 1.98e-5 SMART
FN3 872 947 1.31e-5 SMART
FN3 961 1042 2.31e-6 SMART
FN3 1057 1137 1.2e-4 SMART
low complexity region 1165 1176 N/A INTRINSIC
transmembrane domain 1182 1204 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die shortly after birth despite normal energy homeostasis. Mouse embryonic fibroblasts homozygous for a knock-out allele exhibit impaired adipogenesis and enhanced osteogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik G C 5: 118,259,414 A154P probably damaging Het
Abca7 G T 10: 80,015,188 probably null Het
Abcb4 A G 5: 8,907,399 D176G probably benign Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
AF366264 T A 8: 13,836,625 R489W probably damaging Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd12 T C 17: 65,985,994 T815A probably benign Het
Arid3a T C 10: 79,931,158 S89P possibly damaging Het
Ass1 A T 2: 31,480,988 D63V probably damaging Het
Atxn3 T A 12: 101,923,078 probably benign Het
Bcap29 C T 12: 31,626,807 S88N probably benign Het
Bsn G T 9: 108,113,235 P1773T probably damaging Het
Ccdc141 A G 2: 77,059,680 S423P probably benign Het
Cfap46 A T 7: 139,680,927 L85Q probably damaging Het
Chd8 T C 14: 52,206,915 R438G probably benign Het
Chd9 T A 8: 90,983,463 M289K probably benign Het
Col14a1 T A 15: 55,449,833 Y26* probably null Het
Colec10 A G 15: 54,459,731 T117A possibly damaging Het
Colq C A 14: 31,544,022 G178V probably damaging Het
Defb3 A T 8: 19,295,140 R37S probably benign Het
Duox1 A G 2: 122,346,252 Y1418C probably damaging Het
Engase C T 11: 118,484,905 S33F probably damaging Het
Erich3 A T 3: 154,763,687 T1259S probably damaging Het
Fam98c T C 7: 29,155,268 T49A possibly damaging Het
Fhod3 T A 18: 25,120,129 F1379I possibly damaging Het
Gm1123 A G 9: 99,014,236 V197A probably damaging Het
Gm4847 A T 1: 166,630,395 V463E probably damaging Het
Gm9772 T C 17: 22,007,207 K32R probably damaging Het
Gm9804 T C 12: 49,401,757 S161P unknown Het
Gpr162 C T 6: 124,861,442 D82N probably benign Het
Grid2ip T C 5: 143,382,875 V650A probably damaging Het
Hs1bp3 T C 12: 8,336,357 V253A probably benign Het
Hsd3b6 T G 3: 98,806,579 K135Q possibly damaging Het
Igfn1 T C 1: 135,959,730 D2532G possibly damaging Het
Iqgap2 A G 13: 95,763,329 Y74H probably benign Het
Itga2 A G 13: 114,877,693 V233A probably benign Het
Kat14 A G 2: 144,404,220 probably benign Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Kera A G 10: 97,609,631 N284S probably benign Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lcmt1 T A 7: 123,410,812 C183* probably null Het
Lcn5 A G 2: 25,658,063 E28G possibly damaging Het
Leo1 A T 9: 75,445,697 D174V probably damaging Het
Llgl1 A T 11: 60,709,985 T636S probably damaging Het
Lrrc8e T A 8: 4,233,981 C69S probably damaging Het
Maml3 A T 3: 51,796,470 probably benign Het
Maz G T 7: 127,025,347 H334N possibly damaging Het
Mcm6 T C 1: 128,351,548 D167G probably benign Het
Mrpl24 A C 3: 87,922,129 probably null Het
Myo18a G A 11: 77,824,136 V834M probably damaging Het
Neb T A 2: 52,308,350 R461* probably null Het
Notch4 C A 17: 34,570,185 T486N probably damaging Het
Nphp3 A G 9: 104,003,058 E93G probably damaging Het
Nup188 A G 2: 30,329,346 Y858C probably damaging Het
Olfr339 T A 2: 36,421,857 L153* probably null Het
Olfr45 T A 7: 140,691,378 S158T probably benign Het
Olfr61 C T 7: 140,638,384 R228C probably benign Het
Otud4 T A 8: 79,639,968 D21E possibly damaging Het
Ovgp1 T A 3: 105,980,323 probably null Het
Pdia3 A T 2: 121,414,139 N11I possibly damaging Het
Pex5 T C 6: 124,403,120 D286G possibly damaging Het
Pias3 T C 3: 96,699,820 I133T probably damaging Het
Postn A G 3: 54,372,157 D352G probably damaging Het
Prl7c1 T C 13: 27,778,082 R81G probably benign Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Rtraf T A 14: 19,817,087 N116I probably benign Het
Slc6a12 T A 6: 121,351,992 C50* probably null Het
Srcin1 T A 11: 97,548,926 H126L probably benign Het
Tmtc2 A T 10: 105,303,650 S672T probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ube2c A G 2: 164,772,173 N143S possibly damaging Het
Uroc1 A T 6: 90,355,328 I556F probably damaging Het
Vmn1r124 T A 7: 21,260,377 K81* probably null Het
Vmn1r57 T A 7: 5,220,973 C166S probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r68 A G 7: 85,234,465 V144A probably benign Het
Vmn2r85 C T 10: 130,425,366 M367I probably benign Het
Vwa3a T A 7: 120,793,375 N812K probably benign Het
Wdfy4 A T 14: 33,102,558 N1301K probably damaging Het
Zfhx4 G A 3: 5,403,476 R2898H probably damaging Het
Other mutations in Fndc3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Fndc3b APN 3 27538012 missense probably benign 0.40
IGL00848:Fndc3b APN 3 27451509 missense probably damaging 1.00
IGL01099:Fndc3b APN 3 27463817 missense probably benign 0.10
IGL01459:Fndc3b APN 3 27461740 missense probably benign 0.11
IGL01583:Fndc3b APN 3 27428995 missense probably damaging 1.00
IGL01736:Fndc3b APN 3 27467403 missense probably damaging 1.00
IGL02154:Fndc3b APN 3 27538117 missense probably damaging 0.99
IGL02377:Fndc3b APN 3 27620652 missense probably damaging 1.00
IGL02470:Fndc3b APN 3 27461720 missense probably damaging 1.00
IGL02508:Fndc3b APN 3 27458751 missense probably damaging 1.00
IGL02834:Fndc3b APN 3 27508503 missense probably damaging 1.00
IGL02974:Fndc3b APN 3 27488276 missense probably damaging 1.00
IGL02999:Fndc3b APN 3 27538239 missense probably damaging 1.00
IGL03083:Fndc3b APN 3 27467427 missense probably benign 0.10
R0040:Fndc3b UTSW 3 27556117 splice site probably null
R0040:Fndc3b UTSW 3 27556117 splice site probably null
R0101:Fndc3b UTSW 3 27458808 missense probably damaging 1.00
R0279:Fndc3b UTSW 3 27457006 missense probably benign 0.30
R0281:Fndc3b UTSW 3 27457006 missense probably benign 0.30
R0325:Fndc3b UTSW 3 27467430 missense probably damaging 1.00
R0398:Fndc3b UTSW 3 27461779 missense probably benign 0.19
R1334:Fndc3b UTSW 3 27458851 missense probably damaging 1.00
R1464:Fndc3b UTSW 3 27440185 splice site probably benign
R1961:Fndc3b UTSW 3 27456451 nonsense probably null
R1993:Fndc3b UTSW 3 27419400 missense probably benign
R2087:Fndc3b UTSW 3 27451554 missense probably benign 0.00
R2113:Fndc3b UTSW 3 27643036 missense probably damaging 1.00
R2258:Fndc3b UTSW 3 27440160 missense possibly damaging 0.93
R2437:Fndc3b UTSW 3 27451332 missense probably damaging 0.99
R2930:Fndc3b UTSW 3 27470286 missense probably benign
R2997:Fndc3b UTSW 3 27468872 missense probably benign 0.00
R3151:Fndc3b UTSW 3 27419503 missense possibly damaging 0.93
R3782:Fndc3b UTSW 3 27459986 missense possibly damaging 0.81
R4255:Fndc3b UTSW 3 27501407 missense possibly damaging 0.77
R4747:Fndc3b UTSW 3 27428965 missense probably damaging 0.98
R4849:Fndc3b UTSW 3 27459948 missense probably damaging 1.00
R5185:Fndc3b UTSW 3 27457070 missense probably benign 0.14
R5291:Fndc3b UTSW 3 27642995 missense probably benign 0.39
R5392:Fndc3b UTSW 3 27465787 nonsense probably null
R5540:Fndc3b UTSW 3 27501502 missense probably damaging 1.00
R5554:Fndc3b UTSW 3 27643013 missense possibly damaging 0.69
R5635:Fndc3b UTSW 3 27541931 missense probably damaging 1.00
R5639:Fndc3b UTSW 3 27426153 missense probably damaging 0.98
R5678:Fndc3b UTSW 3 27429023 missense probably benign
R5732:Fndc3b UTSW 3 27461773 missense probably damaging 1.00
R5880:Fndc3b UTSW 3 27428903 missense probably damaging 1.00
R6539:Fndc3b UTSW 3 27538057 missense probably benign 0.22
X0028:Fndc3b UTSW 3 27451434 missense possibly damaging 0.72
Z1088:Fndc3b UTSW 3 27465808 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTAGGCTCCCAAAGATGTTTTGC -3'
(R):5'- CAGGAAATTACGCCAGCCATG -3'

Sequencing Primer
(F):5'- CTCCCAAAGATGTTTTGCTTGGTG -3'
(R):5'- AGCCATGGTTTCAGGCTGTC -3'
Posted On2015-10-08