Incidental Mutation 'R4628:Grid2ip'
ID348941
Institutional Source Beutler Lab
Gene Symbol Grid2ip
Ensembl Gene ENSMUSG00000010825
Gene Nameglutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1
Synonymsdelphilin
MMRRC Submission 041893-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R4628 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location143357338-143392152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 143382875 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 650 (V650A)
Ref Sequence ENSEMBL: ENSMUSP00000113443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010969] [ENSMUST00000110733] [ENSMUST00000120825]
Predicted Effect probably damaging
Transcript: ENSMUST00000010969
AA Change: V643A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000010969
Gene: ENSMUSG00000010825
AA Change: V643A

DomainStartEndE-ValueType
low complexity region 30 55 N/A INTRINSIC
low complexity region 57 73 N/A INTRINSIC
low complexity region 78 92 N/A INTRINSIC
PDZ 97 166 9.5e-16 SMART
low complexity region 256 272 N/A INTRINSIC
low complexity region 284 304 N/A INTRINSIC
low complexity region 429 446 N/A INTRINSIC
low complexity region 464 478 N/A INTRINSIC
low complexity region 536 584 N/A INTRINSIC
low complexity region 607 625 N/A INTRINSIC
FH2 633 1022 1.39e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110733
AA Change: V822A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106361
Gene: ENSMUSG00000010825
AA Change: V822A

DomainStartEndE-ValueType
PDZ 10 80 1.13e-13 SMART
low complexity region 98 109 N/A INTRINSIC
low complexity region 209 234 N/A INTRINSIC
low complexity region 236 252 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
PDZ 276 345 9.5e-16 SMART
low complexity region 435 451 N/A INTRINSIC
low complexity region 463 483 N/A INTRINSIC
low complexity region 608 625 N/A INTRINSIC
low complexity region 643 657 N/A INTRINSIC
low complexity region 715 763 N/A INTRINSIC
low complexity region 786 804 N/A INTRINSIC
FH2 812 1201 1.39e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120825
AA Change: V650A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113443
Gene: ENSMUSG00000010825
AA Change: V650A

DomainStartEndE-ValueType
low complexity region 37 62 N/A INTRINSIC
low complexity region 64 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
PDZ 104 173 9.5e-16 SMART
low complexity region 263 279 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
low complexity region 436 453 N/A INTRINSIC
low complexity region 471 485 N/A INTRINSIC
low complexity region 543 591 N/A INTRINSIC
low complexity region 614 632 N/A INTRINSIC
FH2 640 1029 1.39e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138948
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glutamate receptor delta-2 (GRID2; MIM 602368) is predominantly expressed at parallel fiber-Purkinje cell postsynapses and plays crucial roles in synaptogenesis and synaptic plasticity. GRID2IP1 interacts with GRID2 and may control GRID2 signaling in Purkinje cells (Matsuda et al., 2006 [PubMed 16835239]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display facilitated long-term depression induction at parallel fiber-Purkinje cell synapses as well as enhanced optokinetic response adaptation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik G C 5: 118,259,414 A154P probably damaging Het
Abca7 G T 10: 80,015,188 probably null Het
Abcb4 A G 5: 8,907,399 D176G probably benign Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
AF366264 T A 8: 13,836,625 R489W probably damaging Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd12 T C 17: 65,985,994 T815A probably benign Het
Arid3a T C 10: 79,931,158 S89P possibly damaging Het
Ass1 A T 2: 31,480,988 D63V probably damaging Het
Atxn3 T A 12: 101,923,078 probably benign Het
Bcap29 C T 12: 31,626,807 S88N probably benign Het
Bsn G T 9: 108,113,235 P1773T probably damaging Het
Ccdc141 A G 2: 77,059,680 S423P probably benign Het
Cfap46 A T 7: 139,680,927 L85Q probably damaging Het
Chd8 T C 14: 52,206,915 R438G probably benign Het
Chd9 T A 8: 90,983,463 M289K probably benign Het
Col14a1 T A 15: 55,449,833 Y26* probably null Het
Colec10 A G 15: 54,459,731 T117A possibly damaging Het
Colq C A 14: 31,544,022 G178V probably damaging Het
Defb3 A T 8: 19,295,140 R37S probably benign Het
Duox1 A G 2: 122,346,252 Y1418C probably damaging Het
Engase C T 11: 118,484,905 S33F probably damaging Het
Erich3 A T 3: 154,763,687 T1259S probably damaging Het
Fam98c T C 7: 29,155,268 T49A possibly damaging Het
Fhod3 T A 18: 25,120,129 F1379I possibly damaging Het
Fndc3b T C 3: 27,556,128 I86V probably benign Het
Gm1123 A G 9: 99,014,236 V197A probably damaging Het
Gm4847 A T 1: 166,630,395 V463E probably damaging Het
Gm9772 T C 17: 22,007,207 K32R probably damaging Het
Gm9804 T C 12: 49,401,757 S161P unknown Het
Gpr162 C T 6: 124,861,442 D82N probably benign Het
Hs1bp3 T C 12: 8,336,357 V253A probably benign Het
Hsd3b6 T G 3: 98,806,579 K135Q possibly damaging Het
Igfn1 T C 1: 135,959,730 D2532G possibly damaging Het
Iqgap2 A G 13: 95,763,329 Y74H probably benign Het
Itga2 A G 13: 114,877,693 V233A probably benign Het
Kat14 A G 2: 144,404,220 probably benign Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Kera A G 10: 97,609,631 N284S probably benign Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lcmt1 T A 7: 123,410,812 C183* probably null Het
Lcn5 A G 2: 25,658,063 E28G possibly damaging Het
Leo1 A T 9: 75,445,697 D174V probably damaging Het
Llgl1 A T 11: 60,709,985 T636S probably damaging Het
Lrrc8e T A 8: 4,233,981 C69S probably damaging Het
Maml3 A T 3: 51,796,470 probably benign Het
Maz G T 7: 127,025,347 H334N possibly damaging Het
Mcm6 T C 1: 128,351,548 D167G probably benign Het
Mrpl24 A C 3: 87,922,129 probably null Het
Myo18a G A 11: 77,824,136 V834M probably damaging Het
Neb T A 2: 52,308,350 R461* probably null Het
Notch4 C A 17: 34,570,185 T486N probably damaging Het
Nphp3 A G 9: 104,003,058 E93G probably damaging Het
Nup188 A G 2: 30,329,346 Y858C probably damaging Het
Olfr339 T A 2: 36,421,857 L153* probably null Het
Olfr45 T A 7: 140,691,378 S158T probably benign Het
Olfr61 C T 7: 140,638,384 R228C probably benign Het
Otud4 T A 8: 79,639,968 D21E possibly damaging Het
Ovgp1 T A 3: 105,980,323 probably null Het
Pdia3 A T 2: 121,414,139 N11I possibly damaging Het
Pex5 T C 6: 124,403,120 D286G possibly damaging Het
Pias3 T C 3: 96,699,820 I133T probably damaging Het
Postn A G 3: 54,372,157 D352G probably damaging Het
Prl7c1 T C 13: 27,778,082 R81G probably benign Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Rtraf T A 14: 19,817,087 N116I probably benign Het
Slc6a12 T A 6: 121,351,992 C50* probably null Het
Srcin1 T A 11: 97,548,926 H126L probably benign Het
Tmtc2 A T 10: 105,303,650 S672T probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ube2c A G 2: 164,772,173 N143S possibly damaging Het
Uroc1 A T 6: 90,355,328 I556F probably damaging Het
Vmn1r124 T A 7: 21,260,377 K81* probably null Het
Vmn1r57 T A 7: 5,220,973 C166S probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r68 A G 7: 85,234,465 V144A probably benign Het
Vmn2r85 C T 10: 130,425,366 M367I probably benign Het
Vwa3a T A 7: 120,793,375 N812K probably benign Het
Wdfy4 A T 14: 33,102,558 N1301K probably damaging Het
Zfhx4 G A 3: 5,403,476 R2898H probably damaging Het
Other mutations in Grid2ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02271:Grid2ip APN 5 143388909 missense probably benign
IGL02894:Grid2ip APN 5 143391108 missense probably benign 0.04
R0024:Grid2ip UTSW 5 143391041 missense probably damaging 1.00
R0355:Grid2ip UTSW 5 143357897 missense probably benign 0.10
R0403:Grid2ip UTSW 5 143357620 missense possibly damaging 0.84
R0523:Grid2ip UTSW 5 143373043 missense possibly damaging 0.85
R0605:Grid2ip UTSW 5 143379362 missense probably damaging 0.99
R0664:Grid2ip UTSW 5 143363977 critical splice donor site probably null
R1116:Grid2ip UTSW 5 143382914 missense possibly damaging 0.96
R1251:Grid2ip UTSW 5 143386015 missense possibly damaging 0.69
R1381:Grid2ip UTSW 5 143362651 missense probably benign 0.00
R1384:Grid2ip UTSW 5 143386096 critical splice donor site probably null
R1477:Grid2ip UTSW 5 143375585 missense probably damaging 1.00
R2266:Grid2ip UTSW 5 143386092 missense probably benign 0.01
R2267:Grid2ip UTSW 5 143386092 missense probably benign 0.01
R2304:Grid2ip UTSW 5 143387840 missense probably damaging 1.00
R2871:Grid2ip UTSW 5 143357929 missense probably benign
R2871:Grid2ip UTSW 5 143357929 missense probably benign
R2873:Grid2ip UTSW 5 143357929 missense probably benign
R2874:Grid2ip UTSW 5 143357929 missense probably benign
R3196:Grid2ip UTSW 5 143388178 missense probably damaging 0.99
R3622:Grid2ip UTSW 5 143386019 missense probably damaging 1.00
R3930:Grid2ip UTSW 5 143386039 missense probably damaging 1.00
R4696:Grid2ip UTSW 5 143391376 intron probably benign
R4709:Grid2ip UTSW 5 143388903 missense probably damaging 1.00
R4772:Grid2ip UTSW 5 143375700 missense possibly damaging 0.91
R4838:Grid2ip UTSW 5 143388775 nonsense probably null
R4857:Grid2ip UTSW 5 143382629 missense probably damaging 1.00
R5243:Grid2ip UTSW 5 143377505 missense probably damaging 1.00
R5894:Grid2ip UTSW 5 143388911 missense probably damaging 1.00
R6014:Grid2ip UTSW 5 143387823 missense possibly damaging 0.84
R6076:Grid2ip UTSW 5 143387375 missense probably benign 0.17
R6209:Grid2ip UTSW 5 143380429 missense probably damaging 1.00
R6257:Grid2ip UTSW 5 143380429 missense probably damaging 1.00
R6274:Grid2ip UTSW 5 143380429 missense probably damaging 1.00
R6439:Grid2ip UTSW 5 143373502 missense probably damaging 0.99
X0010:Grid2ip UTSW 5 143357878 missense probably benign 0.01
X0012:Grid2ip UTSW 5 143362639 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTCCATGACCCCAAGCCTAG -3'
(R):5'- CCGCCCCAATTTAATAAATGTAATG -3'

Sequencing Primer
(F):5'- AAGCCTAGCTCCCGCAC -3'
(R):5'- AGGAAGAGGTGGTGGTGGTG -3'
Posted On2015-10-08