Incidental Mutation 'R4628:Fam98c'
ID348949
Institutional Source Beutler Lab
Gene Symbol Fam98c
Ensembl Gene ENSMUSG00000030590
Gene Namefamily with sequence similarity 98, member C
Synonyms
MMRRC Submission 041893-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.331) question?
Stock #R4628 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location29152510-29156234 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29155268 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 49 (T49A)
Ref Sequence ENSEMBL: ENSMUSP00000122992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032811] [ENSMUST00000048923] [ENSMUST00000094617] [ENSMUST00000123416] [ENSMUST00000134176] [ENSMUST00000159351] [ENSMUST00000159975] [ENSMUST00000160396] [ENSMUST00000161522] [ENSMUST00000164589] [ENSMUST00000203070] [ENSMUST00000203380] [ENSMUST00000204194] [ENSMUST00000204845] [ENSMUST00000205027]
Predicted Effect probably benign
Transcript: ENSMUST00000032811
SMART Domains Protein: ENSMUSP00000032811
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 1e-30 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 433 2.92e-70 SMART
C1 541 590 4.12e-12 SMART
low complexity region 600 609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000048923
SMART Domains Protein: ENSMUSP00000046216
Gene: ENSMUSG00000037239

DomainStartEndE-ValueType
Pfam:WH1 1 110 1.6e-13 PFAM
low complexity region 120 130 N/A INTRINSIC
low complexity region 142 153 N/A INTRINSIC
Pfam:Sprouty 292 400 7.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094617
SMART Domains Protein: ENSMUSP00000092200
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 163 2e-29 BLAST
low complexity region 164 189 N/A INTRINSIC
RasGEF 198 434 2.92e-70 SMART
C1 542 596 1.81e-8 SMART
low complexity region 606 615 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000123416
AA Change: T49A

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122992
Gene: ENSMUSG00000030590
AA Change: T49A

DomainStartEndE-ValueType
Pfam:DUF2465 6 125 8.9e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123545
Predicted Effect probably benign
Transcript: ENSMUST00000134176
SMART Domains Protein: ENSMUSP00000120165
Gene: ENSMUSG00000030590

DomainStartEndE-ValueType
Pfam:DUF2465 1 125 5.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136256
AA Change: T138A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000118932
Gene: ENSMUSG00000030590
AA Change: T138A

DomainStartEndE-ValueType
Pfam:DUF2465 6 273 7e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138084
Predicted Effect unknown
Transcript: ENSMUST00000144795
AA Change: T134A
SMART Domains Protein: ENSMUSP00000121796
Gene: ENSMUSG00000030590
AA Change: T134A

DomainStartEndE-ValueType
Pfam:DUF2465 5 175 1.7e-30 PFAM
Pfam:DUF2465 172 213 1.3e-14 PFAM
Pfam:DUF2465 211 242 6.9e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147561
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150431
Predicted Effect unknown
Transcript: ENSMUST00000153251
AA Change: T45A
SMART Domains Protein: ENSMUSP00000117500
Gene: ENSMUSG00000030590
AA Change: T45A

DomainStartEndE-ValueType
Pfam:DUF2465 1 114 1.9e-22 PFAM
Pfam:DUF2465 111 196 1.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159351
SMART Domains Protein: ENSMUSP00000124183
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 7e-31 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 433 2.92e-70 SMART
Blast:RasGEF 449 553 7e-25 BLAST
SCOP:d1ptq__ 541 573 1e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159898
Predicted Effect probably benign
Transcript: ENSMUST00000159975
SMART Domains Protein: ENSMUSP00000125137
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 1e-30 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 433 2.92e-70 SMART
C1 541 595 1.81e-8 SMART
low complexity region 605 614 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160396
Predicted Effect probably benign
Transcript: ENSMUST00000161522
SMART Domains Protein: ENSMUSP00000123718
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 165 7e-32 BLAST
RasGEF 183 419 2.92e-70 SMART
C1 527 576 4.12e-12 SMART
low complexity region 586 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164589
AA Change: T138A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000131477
Gene: ENSMUSG00000030590
AA Change: T138A

DomainStartEndE-ValueType
Pfam:DUF2465 8 327 3.8e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184073
Predicted Effect probably benign
Transcript: ENSMUST00000203070
SMART Domains Protein: ENSMUSP00000145352
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 197 504 1.8e-20 SMART
C1 449 498 2.1e-14 SMART
low complexity region 508 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203380
SMART Domains Protein: ENSMUSP00000144753
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 197 364 3e-25 SMART
C1 472 521 2.1e-14 SMART
low complexity region 531 540 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204194
SMART Domains Protein: ENSMUSP00000145259
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 85 336 1e-7 SMART
C1 444 493 2.1e-14 SMART
low complexity region 503 512 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204845
SMART Domains Protein: ENSMUSP00000144774
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 197 399 8.7e-49 SMART
C1 507 556 2.1e-14 SMART
low complexity region 566 575 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205027
SMART Domains Protein: ENSMUSP00000145186
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
C1 352 401 2.1e-14 SMART
low complexity region 411 420 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205672
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik G C 5: 118,259,414 A154P probably damaging Het
Abca7 G T 10: 80,015,188 probably null Het
Abcb4 A G 5: 8,907,399 D176G probably benign Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
AF366264 T A 8: 13,836,625 R489W probably damaging Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd12 T C 17: 65,985,994 T815A probably benign Het
Arid3a T C 10: 79,931,158 S89P possibly damaging Het
Ass1 A T 2: 31,480,988 D63V probably damaging Het
Atxn3 T A 12: 101,923,078 probably benign Het
Bcap29 C T 12: 31,626,807 S88N probably benign Het
Bsn G T 9: 108,113,235 P1773T probably damaging Het
Ccdc141 A G 2: 77,059,680 S423P probably benign Het
Cfap46 A T 7: 139,680,927 L85Q probably damaging Het
Chd8 T C 14: 52,206,915 R438G probably benign Het
Chd9 T A 8: 90,983,463 M289K probably benign Het
Col14a1 T A 15: 55,449,833 Y26* probably null Het
Colec10 A G 15: 54,459,731 T117A possibly damaging Het
Colq C A 14: 31,544,022 G178V probably damaging Het
Defb3 A T 8: 19,295,140 R37S probably benign Het
Duox1 A G 2: 122,346,252 Y1418C probably damaging Het
Engase C T 11: 118,484,905 S33F probably damaging Het
Erich3 A T 3: 154,763,687 T1259S probably damaging Het
Fhod3 T A 18: 25,120,129 F1379I possibly damaging Het
Fndc3b T C 3: 27,556,128 I86V probably benign Het
Gm1123 A G 9: 99,014,236 V197A probably damaging Het
Gm4847 A T 1: 166,630,395 V463E probably damaging Het
Gm9772 T C 17: 22,007,207 K32R probably damaging Het
Gm9804 T C 12: 49,401,757 S161P unknown Het
Gpr162 C T 6: 124,861,442 D82N probably benign Het
Grid2ip T C 5: 143,382,875 V650A probably damaging Het
Hs1bp3 T C 12: 8,336,357 V253A probably benign Het
Hsd3b6 T G 3: 98,806,579 K135Q possibly damaging Het
Igfn1 T C 1: 135,959,730 D2532G possibly damaging Het
Iqgap2 A G 13: 95,763,329 Y74H probably benign Het
Itga2 A G 13: 114,877,693 V233A probably benign Het
Kat14 A G 2: 144,404,220 probably benign Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Kera A G 10: 97,609,631 N284S probably benign Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lcmt1 T A 7: 123,410,812 C183* probably null Het
Lcn5 A G 2: 25,658,063 E28G possibly damaging Het
Leo1 A T 9: 75,445,697 D174V probably damaging Het
Llgl1 A T 11: 60,709,985 T636S probably damaging Het
Lrrc8e T A 8: 4,233,981 C69S probably damaging Het
Maml3 A T 3: 51,796,470 probably benign Het
Maz G T 7: 127,025,347 H334N possibly damaging Het
Mcm6 T C 1: 128,351,548 D167G probably benign Het
Mrpl24 A C 3: 87,922,129 probably null Het
Myo18a G A 11: 77,824,136 V834M probably damaging Het
Neb T A 2: 52,308,350 R461* probably null Het
Notch4 C A 17: 34,570,185 T486N probably damaging Het
Nphp3 A G 9: 104,003,058 E93G probably damaging Het
Nup188 A G 2: 30,329,346 Y858C probably damaging Het
Olfr339 T A 2: 36,421,857 L153* probably null Het
Olfr45 T A 7: 140,691,378 S158T probably benign Het
Olfr61 C T 7: 140,638,384 R228C probably benign Het
Otud4 T A 8: 79,639,968 D21E possibly damaging Het
Ovgp1 T A 3: 105,980,323 probably null Het
Pdia3 A T 2: 121,414,139 N11I possibly damaging Het
Pex5 T C 6: 124,403,120 D286G possibly damaging Het
Pias3 T C 3: 96,699,820 I133T probably damaging Het
Postn A G 3: 54,372,157 D352G probably damaging Het
Prl7c1 T C 13: 27,778,082 R81G probably benign Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Rtraf T A 14: 19,817,087 N116I probably benign Het
Slc6a12 T A 6: 121,351,992 C50* probably null Het
Srcin1 T A 11: 97,548,926 H126L probably benign Het
Tmtc2 A T 10: 105,303,650 S672T probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ube2c A G 2: 164,772,173 N143S possibly damaging Het
Uroc1 A T 6: 90,355,328 I556F probably damaging Het
Vmn1r124 T A 7: 21,260,377 K81* probably null Het
Vmn1r57 T A 7: 5,220,973 C166S probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r68 A G 7: 85,234,465 V144A probably benign Het
Vmn2r85 C T 10: 130,425,366 M367I probably benign Het
Vwa3a T A 7: 120,793,375 N812K probably benign Het
Wdfy4 A T 14: 33,102,558 N1301K probably damaging Het
Zfhx4 G A 3: 5,403,476 R2898H probably damaging Het
Other mutations in Fam98c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Fam98c APN 7 29152853 unclassified probably benign
IGL02603:Fam98c APN 7 29154448 missense probably damaging 1.00
IGL02638:Fam98c APN 7 29152762 missense probably damaging 1.00
R0147:Fam98c UTSW 7 29152721 nonsense probably null
R1248:Fam98c UTSW 7 29152840 missense probably damaging 1.00
R4627:Fam98c UTSW 7 29155268 missense possibly damaging 0.71
R4629:Fam98c UTSW 7 29155268 missense possibly damaging 0.71
R4688:Fam98c UTSW 7 29155241 missense probably damaging 1.00
R5247:Fam98c UTSW 7 29155701 missense possibly damaging 0.84
R6254:Fam98c UTSW 7 29154517 missense probably damaging 1.00
R6354:Fam98c UTSW 7 29152847 missense probably damaging 1.00
R6388:Fam98c UTSW 7 29155303 missense probably damaging 0.98
R6433:Fam98c UTSW 7 29156128 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AACAGGCTCCTTTCCACAAG -3'
(R):5'- AGGCCTCTGAAAACTTTAATGC -3'

Sequencing Primer
(F):5'- GGCTCCTTTCCACAAGTAAGG -3'
(R):5'- TGGTTCTGAAGTGGACCCAC -3'
Posted On2015-10-08