Incidental Mutation 'R4628:Col14a1'
ID348995
Institutional Source Beutler Lab
Gene Symbol Col14a1
Ensembl Gene ENSMUSG00000022371
Gene Namecollagen, type XIV, alpha 1
Synonyms5730412L22Rik
MMRRC Submission 041893-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4628 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location55307750-55520803 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 55449833 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 26 (Y26*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023053] [ENSMUST00000110217] [ENSMUST00000110221]
Predicted Effect probably null
Transcript: ENSMUST00000023053
AA Change: Y1287*
SMART Domains Protein: ENSMUSP00000023053
Gene: ENSMUSG00000022371
AA Change: Y1287*

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FN3 30 108 5.4e-7 SMART
low complexity region 122 136 N/A INTRINSIC
VWA 157 336 9.5e-56 SMART
FN3 354 434 3.82e-7 SMART
FN3 444 522 3.1e-7 SMART
FN3 536 613 5.07e-12 SMART
FN3 625 704 3.1e-7 SMART
FN3 736 818 6.2e-7 SMART
FN3 830 909 1.45e-7 SMART
FN3 920 999 3.59e0 SMART
low complexity region 1010 1022 N/A INTRINSIC
VWA 1031 1211 2.02e-59 SMART
TSPN 1230 1425 1.19e-66 SMART
Pfam:Collagen 1461 1515 2.9e-8 PFAM
Pfam:Collagen 1513 1571 6.3e-9 PFAM
Pfam:Collagen 1555 1615 8.5e-10 PFAM
Pfam:Collagen 1653 1709 7.6e-10 PFAM
Pfam:Collagen 1707 1762 2.6e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110217
AA Change: Y1288*
SMART Domains Protein: ENSMUSP00000105846
Gene: ENSMUSG00000022371
AA Change: Y1288*

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FN3 30 108 5.4e-7 SMART
low complexity region 122 136 N/A INTRINSIC
VWA 157 336 9.5e-56 SMART
FN3 354 434 3.82e-7 SMART
FN3 444 522 3.1e-7 SMART
FN3 536 613 5.07e-12 SMART
FN3 625 704 3.1e-7 SMART
FN3 736 819 5.4e-7 SMART
FN3 831 910 1.45e-7 SMART
FN3 921 1000 3.59e0 SMART
low complexity region 1011 1023 N/A INTRINSIC
VWA 1032 1212 2.02e-59 SMART
TSPN 1231 1426 1.19e-66 SMART
Pfam:Collagen 1462 1516 2.5e-8 PFAM
Pfam:Collagen 1514 1572 5.4e-9 PFAM
Pfam:Collagen 1556 1616 7.3e-10 PFAM
Pfam:Collagen 1654 1710 6.5e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110221
AA Change: Y1284*
SMART Domains Protein: ENSMUSP00000105850
Gene: ENSMUSG00000022371
AA Change: Y1284*

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FN3 30 108 5.4e-7 SMART
low complexity region 122 136 N/A INTRINSIC
VWA 157 336 9.5e-56 SMART
FN3 354 434 3.82e-7 SMART
FN3 444 522 3.1e-7 SMART
FN3 536 613 5.07e-12 SMART
FN3 625 704 3.1e-7 SMART
FN3 736 815 7.12e-7 SMART
FN3 827 906 1.45e-7 SMART
FN3 917 996 3.59e0 SMART
low complexity region 1007 1019 N/A INTRINSIC
VWA 1028 1208 2.02e-59 SMART
TSPN 1227 1422 1.19e-66 SMART
Pfam:Collagen 1458 1512 8.2e-9 PFAM
Pfam:Collagen 1510 1568 1.8e-9 PFAM
Pfam:Collagen 1552 1612 2.4e-10 PFAM
Pfam:Collagen 1650 1706 2.2e-10 PFAM
Pfam:Collagen 1704 1759 7.5e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000125416
AA Change: Y26*
SMART Domains Protein: ENSMUSP00000122455
Gene: ENSMUSG00000022371
AA Change: Y26*

DomainStartEndE-ValueType
TSPN 2 165 2.04e-42 SMART
Pfam:Collagen 201 255 2.1e-9 PFAM
Pfam:Collagen 253 305 3.3e-9 PFAM
Pfam:Collagen 295 355 4.4e-11 PFAM
Pfam:Collagen 393 448 5.7e-11 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XIV collagen, a member of the FACIT (fibril-associated collagens with interrupted triple helices) collagen family. Type XIV collagen interacts with the fibril surface and is involved in the regulation of fibrillogenesis. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a null mutation display abnormal tendon morphology and abnormal biomechanical properties of the skin and tendons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik G C 5: 118,259,414 A154P probably damaging Het
Abca7 G T 10: 80,015,188 probably null Het
Abcb4 A G 5: 8,907,399 D176G probably benign Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
AF366264 T A 8: 13,836,625 R489W probably damaging Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd12 T C 17: 65,985,994 T815A probably benign Het
Arid3a T C 10: 79,931,158 S89P possibly damaging Het
Ass1 A T 2: 31,480,988 D63V probably damaging Het
Atxn3 T A 12: 101,923,078 probably benign Het
Bcap29 C T 12: 31,626,807 S88N probably benign Het
Bsn G T 9: 108,113,235 P1773T probably damaging Het
Ccdc141 A G 2: 77,059,680 S423P probably benign Het
Cfap46 A T 7: 139,680,927 L85Q probably damaging Het
Chd8 T C 14: 52,206,915 R438G probably benign Het
Chd9 T A 8: 90,983,463 M289K probably benign Het
Colec10 A G 15: 54,459,731 T117A possibly damaging Het
Colq C A 14: 31,544,022 G178V probably damaging Het
Defb3 A T 8: 19,295,140 R37S probably benign Het
Duox1 A G 2: 122,346,252 Y1418C probably damaging Het
Engase C T 11: 118,484,905 S33F probably damaging Het
Erich3 A T 3: 154,763,687 T1259S probably damaging Het
Fam98c T C 7: 29,155,268 T49A possibly damaging Het
Fhod3 T A 18: 25,120,129 F1379I possibly damaging Het
Fndc3b T C 3: 27,556,128 I86V probably benign Het
Gm1123 A G 9: 99,014,236 V197A probably damaging Het
Gm4847 A T 1: 166,630,395 V463E probably damaging Het
Gm9772 T C 17: 22,007,207 K32R probably damaging Het
Gm9804 T C 12: 49,401,757 S161P unknown Het
Gpr162 C T 6: 124,861,442 D82N probably benign Het
Grid2ip T C 5: 143,382,875 V650A probably damaging Het
Hs1bp3 T C 12: 8,336,357 V253A probably benign Het
Hsd3b6 T G 3: 98,806,579 K135Q possibly damaging Het
Igfn1 T C 1: 135,959,730 D2532G possibly damaging Het
Iqgap2 A G 13: 95,763,329 Y74H probably benign Het
Itga2 A G 13: 114,877,693 V233A probably benign Het
Kat14 A G 2: 144,404,220 probably benign Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Kera A G 10: 97,609,631 N284S probably benign Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lcmt1 T A 7: 123,410,812 C183* probably null Het
Lcn5 A G 2: 25,658,063 E28G possibly damaging Het
Leo1 A T 9: 75,445,697 D174V probably damaging Het
Llgl1 A T 11: 60,709,985 T636S probably damaging Het
Lrrc8e T A 8: 4,233,981 C69S probably damaging Het
Maml3 A T 3: 51,796,470 probably benign Het
Maz G T 7: 127,025,347 H334N possibly damaging Het
Mcm6 T C 1: 128,351,548 D167G probably benign Het
Mrpl24 A C 3: 87,922,129 probably null Het
Myo18a G A 11: 77,824,136 V834M probably damaging Het
Neb T A 2: 52,308,350 R461* probably null Het
Notch4 C A 17: 34,570,185 T486N probably damaging Het
Nphp3 A G 9: 104,003,058 E93G probably damaging Het
Nup188 A G 2: 30,329,346 Y858C probably damaging Het
Olfr339 T A 2: 36,421,857 L153* probably null Het
Olfr45 T A 7: 140,691,378 S158T probably benign Het
Olfr61 C T 7: 140,638,384 R228C probably benign Het
Otud4 T A 8: 79,639,968 D21E possibly damaging Het
Ovgp1 T A 3: 105,980,323 probably null Het
Pdia3 A T 2: 121,414,139 N11I possibly damaging Het
Pex5 T C 6: 124,403,120 D286G possibly damaging Het
Pias3 T C 3: 96,699,820 I133T probably damaging Het
Postn A G 3: 54,372,157 D352G probably damaging Het
Prl7c1 T C 13: 27,778,082 R81G probably benign Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Rtraf T A 14: 19,817,087 N116I probably benign Het
Slc6a12 T A 6: 121,351,992 C50* probably null Het
Srcin1 T A 11: 97,548,926 H126L probably benign Het
Tmtc2 A T 10: 105,303,650 S672T probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ube2c A G 2: 164,772,173 N143S possibly damaging Het
Uroc1 A T 6: 90,355,328 I556F probably damaging Het
Vmn1r124 T A 7: 21,260,377 K81* probably null Het
Vmn1r57 T A 7: 5,220,973 C166S probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r68 A G 7: 85,234,465 V144A probably benign Het
Vmn2r85 C T 10: 130,425,366 M367I probably benign Het
Vwa3a T A 7: 120,793,375 N812K probably benign Het
Wdfy4 A T 14: 33,102,558 N1301K probably damaging Het
Zfhx4 G A 3: 5,403,476 R2898H probably damaging Het
Other mutations in Col14a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Col14a1 APN 15 55411585 missense unknown
IGL01290:Col14a1 APN 15 55423507 missense unknown
IGL01300:Col14a1 APN 15 55467976 missense unknown
IGL01505:Col14a1 APN 15 55455223 missense unknown
IGL01533:Col14a1 APN 15 55420840 missense unknown
IGL01563:Col14a1 APN 15 55487941 missense unknown
IGL01650:Col14a1 APN 15 55406693 missense unknown
IGL01659:Col14a1 APN 15 55446172 unclassified probably benign
IGL01670:Col14a1 APN 15 55329266 missense unknown
IGL01760:Col14a1 APN 15 55423459 missense unknown
IGL01803:Col14a1 APN 15 55418814 missense unknown
IGL01966:Col14a1 APN 15 55448725 unclassified probably benign
IGL01990:Col14a1 APN 15 55363463 missense unknown
IGL02124:Col14a1 APN 15 55463703 missense unknown
IGL02138:Col14a1 APN 15 55420835 missense unknown
IGL02192:Col14a1 APN 15 55362402 missense unknown
IGL02326:Col14a1 APN 15 55418797 missense unknown
IGL02335:Col14a1 APN 15 55463769 splice site probably benign
IGL02407:Col14a1 APN 15 55448876 splice site probably benign
IGL02486:Col14a1 APN 15 55388696 splice site probably benign
IGL02537:Col14a1 APN 15 55344914 nonsense probably null
IGL02567:Col14a1 APN 15 55344961 critical splice donor site probably null
IGL02643:Col14a1 APN 15 55420862 missense unknown
IGL02669:Col14a1 APN 15 55418782 missense unknown
IGL02673:Col14a1 APN 15 55418782 missense unknown
IGL02674:Col14a1 APN 15 55418782 missense unknown
IGL03201:Col14a1 APN 15 55408904 missense unknown
IGL03334:Col14a1 APN 15 55448821 unclassified probably benign
IGL03370:Col14a1 APN 15 55488541 splice site probably null
IGL03385:Col14a1 APN 15 55410204 missense unknown
IGL03385:Col14a1 APN 15 55471708 missense unknown
PIT4131001:Col14a1 UTSW 15 55448876 splice site probably benign
R0046:Col14a1 UTSW 15 55408963 splice site probably benign
R0046:Col14a1 UTSW 15 55408963 splice site probably benign
R0173:Col14a1 UTSW 15 55488532 missense probably damaging 1.00
R0242:Col14a1 UTSW 15 55497511 missense probably damaging 1.00
R0242:Col14a1 UTSW 15 55497511 missense probably damaging 1.00
R0359:Col14a1 UTSW 15 55407868 splice site probably benign
R0391:Col14a1 UTSW 15 55446259 unclassified probably benign
R0468:Col14a1 UTSW 15 55388646 missense unknown
R0652:Col14a1 UTSW 15 55344882 missense unknown
R0692:Col14a1 UTSW 15 55341738 missense unknown
R0745:Col14a1 UTSW 15 55338417 missense unknown
R1006:Col14a1 UTSW 15 55519935 missense probably benign 0.04
R1331:Col14a1 UTSW 15 55410188 missense unknown
R1537:Col14a1 UTSW 15 55380767 missense unknown
R1557:Col14a1 UTSW 15 55388579 missense unknown
R1721:Col14a1 UTSW 15 55447462 unclassified probably benign
R1737:Col14a1 UTSW 15 55344961 critical splice donor site probably benign
R1837:Col14a1 UTSW 15 55382495 missense unknown
R1867:Col14a1 UTSW 15 55447462 unclassified probably benign
R1868:Col14a1 UTSW 15 55447462 unclassified probably benign
R1991:Col14a1 UTSW 15 55449940 missense unknown
R2020:Col14a1 UTSW 15 55446181 unclassified probably benign
R2103:Col14a1 UTSW 15 55449940 missense unknown
R2116:Col14a1 UTSW 15 55407764 missense unknown
R2163:Col14a1 UTSW 15 55444645 unclassified probably benign
R2207:Col14a1 UTSW 15 55463686 missense unknown
R2215:Col14a1 UTSW 15 55380842 missense unknown
R2264:Col14a1 UTSW 15 55466690 splice site probably null
R2383:Col14a1 UTSW 15 55447517 unclassified probably benign
R2397:Col14a1 UTSW 15 55338439 missense unknown
R2422:Col14a1 UTSW 15 55449922 missense unknown
R3793:Col14a1 UTSW 15 55363513 missense unknown
R4082:Col14a1 UTSW 15 55437033 missense unknown
R4112:Col14a1 UTSW 15 55363559 missense unknown
R4519:Col14a1 UTSW 15 55388579 missense unknown
R4692:Col14a1 UTSW 15 55423468 missense unknown
R4696:Col14a1 UTSW 15 55372602 missense unknown
R4749:Col14a1 UTSW 15 55452336 missense unknown
R5324:Col14a1 UTSW 15 55338445 missense unknown
R5382:Col14a1 UTSW 15 55362436 missense unknown
R5634:Col14a1 UTSW 15 55518298 missense probably damaging 1.00
R5781:Col14a1 UTSW 15 55423512 missense unknown
R5828:Col14a1 UTSW 15 55436976 missense unknown
R5873:Col14a1 UTSW 15 55445786 unclassified probably benign
R5966:Col14a1 UTSW 15 55452383 critical splice donor site probably null
R6106:Col14a1 UTSW 15 55520008 missense probably damaging 1.00
R6135:Col14a1 UTSW 15 55380850 missense unknown
R6319:Col14a1 UTSW 15 55516169 missense probably damaging 0.99
R6475:Col14a1 UTSW 15 55445822 unclassified probably benign
R6540:Col14a1 UTSW 15 55372581 missense unknown
R6893:Col14a1 UTSW 15 55444648 unclassified probably benign
X0023:Col14a1 UTSW 15 55423447 missense unknown
X0063:Col14a1 UTSW 15 55410215 missense unknown
Predicted Primers PCR Primer
(F):5'- GGTAAAGCCCATAGTTAAAGGC -3'
(R):5'- CGAGATGACATTCCACATGCAC -3'

Sequencing Primer
(F):5'- GGTGTATGTCTGTAACCCAAGCAC -3'
(R):5'- CCATCAGGTATACAGCAATTGC -3'
Posted On2015-10-08