Incidental Mutation 'R4629:Cubn'
ID349005
Institutional Source Beutler Lab
Gene Symbol Cubn
Ensembl Gene ENSMUSG00000026726
Gene Namecubilin (intrinsic factor-cobalamin receptor)
SynonymsD2Wsu88e
MMRRC Submission 041894-MU
Accession Numbers

Genbank: NM_001081084; MGI: 1931256

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4629 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location13276338-13491813 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to A at 13313979 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000089009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091436]
Predicted Effect probably null
Transcript: ENSMUST00000091436
SMART Domains Protein: ENSMUSP00000089009
Gene: ENSMUSG00000026726

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 132 165 2.14e-5 SMART
EGF_CA 167 208 1.95e-8 SMART
EGF 213 258 2.85e-1 SMART
EGF_CA 260 301 2.66e-10 SMART
EGF_CA 302 345 7.07e-6 SMART
EGF 349 393 1.01e-1 SMART
EGF 398 430 3.73e-5 SMART
EGF_CA 432 468 8.63e-10 SMART
CUB 474 586 4.4e-21 SMART
CUB 590 702 3.82e-39 SMART
CUB 708 816 3.66e-18 SMART
CUB 817 928 3.09e-25 SMART
CUB 932 1042 1.29e-36 SMART
CUB 1048 1161 3.46e-37 SMART
CUB 1165 1277 7.24e-40 SMART
CUB 1278 1389 8.33e-31 SMART
CUB 1391 1506 3.08e-43 SMART
CUB 1510 1619 1.9e-34 SMART
CUB 1620 1734 7.24e-40 SMART
CUB 1738 1850 6.02e-37 SMART
CUB 1852 1963 1.57e-26 SMART
CUB 1978 2091 3.46e-28 SMART
CUB 2092 2213 2.88e-34 SMART
CUB 2217 2334 4.13e-35 SMART
CUB 2336 2448 3.1e-39 SMART
CUB 2452 2565 5.37e-34 SMART
CUB 2570 2687 3e-23 SMART
CUB 2689 2801 3.1e-39 SMART
CUB 2805 2919 2.36e-21 SMART
CUB 2920 3035 6.18e-25 SMART
CUB 3037 3150 5.16e-36 SMART
CUB 3157 3274 1.68e-35 SMART
CUB 3278 3393 7.17e-12 SMART
CUB 3395 3507 2.49e-29 SMART
CUB 3511 3623 2.4e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149137
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cubilin (CUBN) acts as a receptor for intrinsic factor-vitamin B12 complexes. The role of receptor is supported by the presence of 27 CUB domains. Cubulin is located within the epithelium of intestine and kidney. Mutations in CUBN may play a role in autosomal recessive megaloblastic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, yolk sac and allantoic vasculature defects, embryonic and visceral endoderm defects, and lack somites. Heterozygotes display incomplete penetrance of premature death. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, other(1) Gene trapped(3)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik T C 9: 114,279,351 noncoding transcript Het
Abca6 T C 11: 110,230,549 probably null Het
Adam22 A G 5: 8,232,663 S111P possibly damaging Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Alg10b C T 15: 90,227,745 A264V probably benign Het
Angpt1 T A 15: 42,438,400 Y404F probably benign Het
Apol7c A G 15: 77,526,395 F117S probably damaging Het
Asic5 T A 3: 82,006,504 Y162N probably damaging Het
Cacna2d2 A T 9: 107,527,322 E1104V probably damaging Het
Cad G A 5: 31,070,295 V1263I probably damaging Het
Cdc20 T C 4: 118,433,564 E413G probably damaging Het
Cfap46 A T 7: 139,680,927 L85Q probably damaging Het
Cnot6l A G 5: 96,077,211 V541A probably benign Het
Cx3cr1 T C 9: 120,051,664 N224S probably damaging Het
Fam98c T C 7: 29,155,268 T49A possibly damaging Het
Fez2 C T 17: 78,402,754 S202N probably benign Het
Fras1 A G 5: 96,776,734 N3678S probably benign Het
Glyr1 A G 16: 5,037,043 V57A possibly damaging Het
Gm5617 T A 9: 48,495,887 L107Q possibly damaging Het
Gpnmb A G 6: 49,051,060 D401G possibly damaging Het
Gtpbp6 C A 5: 110,106,908 V100L possibly damaging Het
Gucy1a1 A G 3: 82,097,624 V618A probably damaging Het
H6pd A T 4: 149,996,346 M14K probably benign Het
Hectd4 A G 5: 121,297,203 M993V probably benign Het
Kat14 A G 2: 144,404,220 probably benign Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Kera A G 10: 97,609,631 N284S probably benign Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lama1 A G 17: 67,805,360 probably null Het
Lgr6 T C 1: 135,104,932 Y70C probably damaging Het
Lipg T A 18: 74,948,036 K325* probably null Het
Lrrc43 T C 5: 123,499,520 L250P probably damaging Het
Lyz1 C T 10: 117,291,136 R65H probably benign Het
March10 T A 11: 105,389,838 L540F probably benign Het
Maz G T 7: 127,025,347 H334N possibly damaging Het
Myh1 A G 11: 67,209,293 K646R probably benign Het
Nf2 A T 11: 4,848,915 V24E probably damaging Het
Nup210l T C 3: 90,167,875 S831P probably benign Het
Nup210l C T 3: 90,190,874 R1378* probably null Het
Olfr45 T A 7: 140,691,378 S158T probably benign Het
Orc5 G T 5: 22,548,005 F10L probably benign Het
Palb2 A C 7: 122,127,966 I227S possibly damaging Het
Pate3 A T 9: 35,646,157 C68S probably damaging Het
Pcdha12 T A 18: 37,021,873 N548K probably damaging Het
Prdm10 C T 9: 31,337,316 Q345* probably null Het
Ptx4 A T 17: 25,122,763 N71Y probably damaging Het
Rab42 C T 4: 132,303,237 R34Q probably benign Het
Rergl A G 6: 139,501,852 V8A probably damaging Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Rpia A G 6: 70,766,594 M291T possibly damaging Het
Rplp0 G A 5: 115,561,423 probably null Het
Rrp12 A T 19: 41,883,516 I443N probably benign Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Saxo1 T C 4: 86,487,827 Y45C probably damaging Het
Sec24a A T 11: 51,721,813 probably null Het
Setdb2 A G 14: 59,409,359 V585A probably benign Het
Sik1 T C 17: 31,849,607 E347G probably benign Het
Srbd1 T C 17: 86,120,672 T378A probably damaging Het
Tacr1 A G 6: 82,403,880 T91A probably benign Het
Tas2r135 T A 6: 42,406,226 M233K probably benign Het
Tfg A T 16: 56,712,676 M40K probably damaging Het
Tmem35b C T 4: 127,129,003 P133S probably benign Het
Tmtc2 A T 10: 105,303,650 S672T probably benign Het
Trpv3 A T 11: 73,281,789 K253N probably damaging Het
Ube2c A G 2: 164,772,173 N143S possibly damaging Het
Unc13a A G 8: 71,653,453 M669T possibly damaging Het
Vmn1r61 T A 7: 5,611,250 I22F probably benign Het
Vmn2r26 A T 6: 124,061,191 Q575L possibly damaging Het
Vmn2r81 A T 10: 79,267,442 E156D probably damaging Het
Vwa3a T A 7: 120,793,375 N812K probably benign Het
Wasl T C 6: 24,637,681 R71G probably damaging Het
Wdfy4 A T 14: 33,102,558 N1301K probably damaging Het
Zfp72 A G 13: 74,372,393 C189R probably damaging Het
Zfp827 G A 8: 79,060,382 R59Q probably damaging Het
Other mutations in Cubn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Cubn APN 2 13491820 unclassified probably benign
IGL00228:Cubn APN 2 13456697 missense probably damaging 1.00
IGL00231:Cubn APN 2 13381849 missense possibly damaging 0.89
IGL00327:Cubn APN 2 13427056 missense possibly damaging 0.73
IGL00470:Cubn APN 2 13278418 missense probably benign 0.00
IGL00519:Cubn APN 2 13282919 missense probably benign 0.00
IGL00562:Cubn APN 2 13294230 missense probably benign 0.01
IGL00678:Cubn APN 2 13467710 missense possibly damaging 0.47
IGL00834:Cubn APN 2 13381927 missense probably damaging 1.00
IGL00946:Cubn APN 2 13456623 missense probably damaging 0.98
IGL00971:Cubn APN 2 13278408 missense possibly damaging 0.77
IGL01124:Cubn APN 2 13478093 missense possibly damaging 0.62
IGL01287:Cubn APN 2 13310566 missense probably damaging 1.00
IGL01410:Cubn APN 2 13465908 missense probably benign 0.31
IGL01418:Cubn APN 2 13284041 missense probably benign 0.01
IGL01450:Cubn APN 2 13350862 splice site probably benign
IGL01534:Cubn APN 2 13465933 nonsense probably null
IGL01584:Cubn APN 2 13308661 splice site probably benign
IGL01595:Cubn APN 2 13325216 missense probably benign 0.05
IGL01625:Cubn APN 2 13306274 missense possibly damaging 0.76
IGL01732:Cubn APN 2 13489936 nonsense probably null
IGL01972:Cubn APN 2 13446072 missense possibly damaging 0.90
IGL02027:Cubn APN 2 13287594 missense probably damaging 1.00
IGL02033:Cubn APN 2 13339846 missense probably damaging 0.98
IGL02124:Cubn APN 2 13381837 missense probably damaging 0.99
IGL02335:Cubn APN 2 13427834 splice site probably null
IGL02491:Cubn APN 2 13321228 missense probably damaging 1.00
IGL02686:Cubn APN 2 13325226 missense possibly damaging 0.92
IGL02707:Cubn APN 2 13446032 missense probably damaging 0.99
IGL02746:Cubn APN 2 13445040 missense probably damaging 1.00
IGL02873:Cubn APN 2 13294370 missense probably benign 0.07
IGL02897:Cubn APN 2 13318312 missense possibly damaging 0.55
IGL03078:Cubn APN 2 13287094 missense possibly damaging 0.87
IGL03245:Cubn APN 2 13355689 missense probably benign 0.09
IGL03289:Cubn APN 2 13426967 missense probably benign 0.00
IGL03335:Cubn APN 2 13360329 missense probably damaging 1.00
IGL03355:Cubn APN 2 13478057 splice site probably null
mellow UTSW 2 13478078 missense probably damaging 1.00
PIT4354001:Cubn UTSW 2 13468852 nonsense probably null
PIT4495001:Cubn UTSW 2 13491750 missense probably benign 0.00
R0145:Cubn UTSW 2 13306432 missense probably damaging 1.00
R0220:Cubn UTSW 2 13356709 missense probably damaging 1.00
R0254:Cubn UTSW 2 13424694 missense probably benign 0.01
R0254:Cubn UTSW 2 13440514 missense possibly damaging 0.84
R0254:Cubn UTSW 2 13476035 critical splice donor site probably null
R0360:Cubn UTSW 2 13310507 splice site probably benign
R0364:Cubn UTSW 2 13310507 splice site probably benign
R0383:Cubn UTSW 2 13430959 missense probably damaging 1.00
R0419:Cubn UTSW 2 13469763 missense possibly damaging 0.77
R0419:Cubn UTSW 2 13469764 missense possibly damaging 0.87
R0498:Cubn UTSW 2 13444267 missense probably damaging 0.99
R0560:Cubn UTSW 2 13428680 missense probably damaging 1.00
R0615:Cubn UTSW 2 13360252 splice site probably null
R0735:Cubn UTSW 2 13491689 splice site probably benign
R0780:Cubn UTSW 2 13456613 missense probably damaging 1.00
R0899:Cubn UTSW 2 13362328 missense possibly damaging 0.54
R1118:Cubn UTSW 2 13336242 missense possibly damaging 0.78
R1182:Cubn UTSW 2 13445000 missense probably damaging 0.98
R1439:Cubn UTSW 2 13287568 missense probably damaging 0.96
R1450:Cubn UTSW 2 13360319 missense probably damaging 1.00
R1464:Cubn UTSW 2 13325288 missense possibly damaging 0.87
R1464:Cubn UTSW 2 13325288 missense possibly damaging 0.87
R1476:Cubn UTSW 2 13476120 missense probably benign 0.04
R1508:Cubn UTSW 2 13427105 missense probably benign 0.25
R1532:Cubn UTSW 2 13287661 missense probably damaging 1.00
R1562:Cubn UTSW 2 13427967 missense probably damaging 1.00
R1598:Cubn UTSW 2 13469789 missense probably benign 0.00
R1761:Cubn UTSW 2 13489317 critical splice donor site probably null
R1862:Cubn UTSW 2 13308561 missense probably damaging 1.00
R1874:Cubn UTSW 2 13323002 missense probably damaging 1.00
R1923:Cubn UTSW 2 13310526 missense probably damaging 1.00
R1944:Cubn UTSW 2 13278538 missense probably benign 0.01
R1960:Cubn UTSW 2 13340017 splice site probably null
R2021:Cubn UTSW 2 13308549 missense probably benign 0.09
R2137:Cubn UTSW 2 13336167 missense probably benign 0.01
R2138:Cubn UTSW 2 13444378 missense probably damaging 0.99
R2139:Cubn UTSW 2 13336167 missense probably benign 0.01
R2179:Cubn UTSW 2 13318242 missense possibly damaging 0.85
R2328:Cubn UTSW 2 13404080 nonsense probably null
R2369:Cubn UTSW 2 13491217 missense probably damaging 1.00
R2428:Cubn UTSW 2 13476150 missense probably damaging 1.00
R2435:Cubn UTSW 2 13318272 missense probably damaging 1.00
R2567:Cubn UTSW 2 13278356 splice site probably null
R2850:Cubn UTSW 2 13322953 missense probably damaging 1.00
R2853:Cubn UTSW 2 13430834 missense probably benign 0.00
R2893:Cubn UTSW 2 13358139 missense possibly damaging 0.61
R3107:Cubn UTSW 2 13362347 missense possibly damaging 0.73
R3109:Cubn UTSW 2 13362347 missense possibly damaging 0.73
R3119:Cubn UTSW 2 13358162 missense possibly damaging 0.90
R3405:Cubn UTSW 2 13333508 missense probably benign 0.00
R3703:Cubn UTSW 2 13350943 missense probably damaging 1.00
R3704:Cubn UTSW 2 13350943 missense probably damaging 1.00
R3705:Cubn UTSW 2 13350943 missense probably damaging 1.00
R3764:Cubn UTSW 2 13331585 missense possibly damaging 0.79
R3792:Cubn UTSW 2 13427914 missense probably damaging 1.00
R3802:Cubn UTSW 2 13360353 missense probably benign 0.01
R3813:Cubn UTSW 2 13294325 missense probably damaging 1.00
R3845:Cubn UTSW 2 13283008 missense probably damaging 1.00
R3846:Cubn UTSW 2 13283008 missense probably damaging 1.00
R3900:Cubn UTSW 2 13286980 critical splice donor site probably null
R3921:Cubn UTSW 2 13326677 missense probably damaging 1.00
R4075:Cubn UTSW 2 13313999 missense possibly damaging 0.58
R4082:Cubn UTSW 2 13428563 intron probably benign
R4405:Cubn UTSW 2 13466030 missense probably damaging 1.00
R4615:Cubn UTSW 2 13428749 missense probably damaging 1.00
R4770:Cubn UTSW 2 13314767 missense possibly damaging 0.92
R4799:Cubn UTSW 2 13287024 missense possibly damaging 0.94
R4799:Cubn UTSW 2 13351058 missense probably damaging 1.00
R4812:Cubn UTSW 2 13459076 missense probably damaging 1.00
R4825:Cubn UTSW 2 13325225 missense probably damaging 1.00
R4934:Cubn UTSW 2 13489910 missense probably benign 0.06
R4967:Cubn UTSW 2 13348045 missense probably benign 0.01
R5187:Cubn UTSW 2 13287568 missense probably damaging 0.96
R5232:Cubn UTSW 2 13478202 nonsense probably null
R5305:Cubn UTSW 2 13388939 missense probably damaging 1.00
R5506:Cubn UTSW 2 13491695 splice site probably null
R5530:Cubn UTSW 2 13308523 missense probably damaging 1.00
R5531:Cubn UTSW 2 13350932 missense probably benign 0.00
R5737:Cubn UTSW 2 13388891 missense probably damaging 1.00
R5886:Cubn UTSW 2 13320023 splice site probably benign
R5923:Cubn UTSW 2 13486078 missense possibly damaging 0.73
R6032:Cubn UTSW 2 13325184 missense probably benign 0.12
R6032:Cubn UTSW 2 13325184 missense probably benign 0.12
R6084:Cubn UTSW 2 13430897 missense probably damaging 1.00
R6087:Cubn UTSW 2 13427847 missense probably damaging 1.00
R6133:Cubn UTSW 2 13308618 missense probably benign 0.29
R6181:Cubn UTSW 2 13349876 missense probably benign 0.31
R6301:Cubn UTSW 2 13478078 missense probably damaging 1.00
R6320:Cubn UTSW 2 13280195 missense probably damaging 1.00
R6368:Cubn UTSW 2 13430995 missense probably damaging 0.96
R6368:Cubn UTSW 2 13476123 missense probably damaging 0.98
R6383:Cubn UTSW 2 13427835 critical splice donor site probably null
R6393:Cubn UTSW 2 13355680 missense probably benign 0.08
R6408:Cubn UTSW 2 13294203 missense probably damaging 1.00
R6470:Cubn UTSW 2 13322993 missense possibly damaging 0.87
R6532:Cubn UTSW 2 13459002 missense probably benign 0.01
R6599:Cubn UTSW 2 13310673 missense possibly damaging 0.95
R6629:Cubn UTSW 2 13430872 missense probably damaging 1.00
R6641:Cubn UTSW 2 13476064 missense probably damaging 1.00
R6800:Cubn UTSW 2 13321255 missense probably damaging 1.00
R6823:Cubn UTSW 2 13445029 missense probably benign 0.21
R6847:Cubn UTSW 2 13444253 critical splice donor site probably null
R6885:Cubn UTSW 2 13318278 missense probably damaging 1.00
R6962:Cubn UTSW 2 13348029 missense probably benign 0.03
R6973:Cubn UTSW 2 13381837 missense possibly damaging 0.61
R6975:Cubn UTSW 2 13486789 missense probably damaging 0.99
R7076:Cubn UTSW 2 13306280 missense probably benign 0.00
R7076:Cubn UTSW 2 13306281 missense probably benign 0.10
R7086:Cubn UTSW 2 13319858 missense probably damaging 0.98
R7162:Cubn UTSW 2 13342498 missense probably damaging 0.96
R7203:Cubn UTSW 2 13351003 missense probably benign 0.01
R7292:Cubn UTSW 2 13424739 missense probably damaging 0.99
R7307:Cubn UTSW 2 13340332 missense probably damaging 0.99
R7329:Cubn UTSW 2 13468771 missense probably damaging 0.99
R7395:Cubn UTSW 2 13287064 missense probably damaging 1.00
R7417:Cubn UTSW 2 13426967 missense probably benign 0.00
R7429:Cubn UTSW 2 13322993 missense possibly damaging 0.87
R7430:Cubn UTSW 2 13322993 missense possibly damaging 0.87
R7443:Cubn UTSW 2 13455509 missense probably damaging 1.00
X0018:Cubn UTSW 2 13458986 missense probably damaging 1.00
X0022:Cubn UTSW 2 13476076 missense probably damaging 1.00
X0026:Cubn UTSW 2 13342581 missense probably damaging 1.00
X0063:Cubn UTSW 2 13322962 missense probably damaging 1.00
YA93:Cubn UTSW 2 13383992 missense probably benign 0.21
Z1088:Cubn UTSW 2 13294229 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- AGATAAGAGTTCAGTAATGGTGGATA -3'
(R):5'- ACTACAGACGATAATGAATATCCTGAT -3'

Sequencing Primer
(F):5'- CTGTCCTGTCCTTACAAAGAAGG -3'
(R):5'- CTACAGGTGACATCGTCT -3'
Posted On2015-10-08