Incidental Mutation 'R4629:Ube2c'
ID349007
Institutional Source Beutler Lab
Gene Symbol Ube2c
Ensembl Gene ENSMUSG00000001403
Gene Nameubiquitin-conjugating enzyme E2C
Synonyms1110015A16Rik, D2Ertd695e
MMRRC Submission 041894-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R4629 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location164769898-164778822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 164772173 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 143 (N143S)
Ref Sequence ENSEMBL: ENSMUSP00000001439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001439] [ENSMUST00000017443] [ENSMUST00000088248] [ENSMUST00000103095]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001439
AA Change: N143S

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000001439
Gene: ENSMUSG00000001403
AA Change: N143S

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
UBCc 33 170 8.8e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000017443
SMART Domains Protein: ENSMUSP00000017443
Gene: ENSMUSG00000017299

DomainStartEndE-ValueType
low complexity region 10 30 N/A INTRINSIC
Blast:UBCc 91 157 4e-16 BLAST
low complexity region 158 172 N/A INTRINSIC
Blast:UBCc 248 287 1e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000088248
AA Change: N143S

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000085581
Gene: ENSMUSG00000001403
AA Change: N143S

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
UBCc 33 175 1.88e-64 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103095
SMART Domains Protein: ENSMUSP00000099384
Gene: ENSMUSG00000017300

DomainStartEndE-ValueType
EFh 19 47 2.44e-5 SMART
EFh 55 83 8.31e-8 SMART
EFh 95 123 2.01e-6 SMART
EFh 131 159 8.06e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146846
Meta Mutation Damage Score 0.188 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, ubiquitin-conjugating enzymes, and ubiquitin-protein ligases. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein is required for the destruction of mitotic cyclins and for cell cycle progression, and may be involved in cancer progression. Multiple transcript variants encoding different isoforms have been found for this gene. Pseudogenes of this gene have been defined on chromosomes 4, 14, 15, 18, and 19. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik T C 9: 114,279,351 noncoding transcript Het
Abca6 T C 11: 110,230,549 probably null Het
Adam22 A G 5: 8,232,663 S111P possibly damaging Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Alg10b C T 15: 90,227,745 A264V probably benign Het
Angpt1 T A 15: 42,438,400 Y404F probably benign Het
Apol7c A G 15: 77,526,395 F117S probably damaging Het
Asic5 T A 3: 82,006,504 Y162N probably damaging Het
Cacna2d2 A T 9: 107,527,322 E1104V probably damaging Het
Cad G A 5: 31,070,295 V1263I probably damaging Het
Cdc20 T C 4: 118,433,564 E413G probably damaging Het
Cfap46 A T 7: 139,680,927 L85Q probably damaging Het
Cnot6l A G 5: 96,077,211 V541A probably benign Het
Cubn T A 2: 13,313,979 probably null Het
Cx3cr1 T C 9: 120,051,664 N224S probably damaging Het
Fam98c T C 7: 29,155,268 T49A possibly damaging Het
Fez2 C T 17: 78,402,754 S202N probably benign Het
Fras1 A G 5: 96,776,734 N3678S probably benign Het
Glyr1 A G 16: 5,037,043 V57A possibly damaging Het
Gm5617 T A 9: 48,495,887 L107Q possibly damaging Het
Gpnmb A G 6: 49,051,060 D401G possibly damaging Het
Gtpbp6 C A 5: 110,106,908 V100L possibly damaging Het
Gucy1a1 A G 3: 82,097,624 V618A probably damaging Het
H6pd A T 4: 149,996,346 M14K probably benign Het
Hectd4 A G 5: 121,297,203 M993V probably benign Het
Kat14 A G 2: 144,404,220 probably benign Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Kera A G 10: 97,609,631 N284S probably benign Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lama1 A G 17: 67,805,360 probably null Het
Lgr6 T C 1: 135,104,932 Y70C probably damaging Het
Lipg T A 18: 74,948,036 K325* probably null Het
Lrrc43 T C 5: 123,499,520 L250P probably damaging Het
Lyz1 C T 10: 117,291,136 R65H probably benign Het
March10 T A 11: 105,389,838 L540F probably benign Het
Maz G T 7: 127,025,347 H334N possibly damaging Het
Myh1 A G 11: 67,209,293 K646R probably benign Het
Nf2 A T 11: 4,848,915 V24E probably damaging Het
Nup210l T C 3: 90,167,875 S831P probably benign Het
Nup210l C T 3: 90,190,874 R1378* probably null Het
Olfr45 T A 7: 140,691,378 S158T probably benign Het
Orc5 G T 5: 22,548,005 F10L probably benign Het
Palb2 A C 7: 122,127,966 I227S possibly damaging Het
Pate3 A T 9: 35,646,157 C68S probably damaging Het
Pcdha12 T A 18: 37,021,873 N548K probably damaging Het
Prdm10 C T 9: 31,337,316 Q345* probably null Het
Ptx4 A T 17: 25,122,763 N71Y probably damaging Het
Rab42 C T 4: 132,303,237 R34Q probably benign Het
Rergl A G 6: 139,501,852 V8A probably damaging Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Rpia A G 6: 70,766,594 M291T possibly damaging Het
Rplp0 G A 5: 115,561,423 probably null Het
Rrp12 A T 19: 41,883,516 I443N probably benign Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Saxo1 T C 4: 86,487,827 Y45C probably damaging Het
Sec24a A T 11: 51,721,813 probably null Het
Setdb2 A G 14: 59,409,359 V585A probably benign Het
Sik1 T C 17: 31,849,607 E347G probably benign Het
Srbd1 T C 17: 86,120,672 T378A probably damaging Het
Tacr1 A G 6: 82,403,880 T91A probably benign Het
Tas2r135 T A 6: 42,406,226 M233K probably benign Het
Tfg A T 16: 56,712,676 M40K probably damaging Het
Tmem35b C T 4: 127,129,003 P133S probably benign Het
Tmtc2 A T 10: 105,303,650 S672T probably benign Het
Trpv3 A T 11: 73,281,789 K253N probably damaging Het
Unc13a A G 8: 71,653,453 M669T possibly damaging Het
Vmn1r61 T A 7: 5,611,250 I22F probably benign Het
Vmn2r26 A T 6: 124,061,191 Q575L possibly damaging Het
Vmn2r81 A T 10: 79,267,442 E156D probably damaging Het
Vwa3a T A 7: 120,793,375 N812K probably benign Het
Wasl T C 6: 24,637,681 R71G probably damaging Het
Wdfy4 A T 14: 33,102,558 N1301K probably damaging Het
Zfp72 A G 13: 74,372,393 C189R probably damaging Het
Zfp827 G A 8: 79,060,382 R59Q probably damaging Het
Other mutations in Ube2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Ube2c APN 2 164771293 missense probably benign 0.00
IGL01619:Ube2c APN 2 164771312 missense probably damaging 1.00
R1726:Ube2c UTSW 2 164771317 missense probably damaging 1.00
R1748:Ube2c UTSW 2 164771321 missense probably damaging 1.00
R1854:Ube2c UTSW 2 164771362 missense probably damaging 0.99
R1864:Ube2c UTSW 2 164770023 missense probably benign 0.13
R4624:Ube2c UTSW 2 164772173 missense possibly damaging 0.73
R4627:Ube2c UTSW 2 164772173 missense possibly damaging 0.73
R4628:Ube2c UTSW 2 164772173 missense possibly damaging 0.73
R4810:Ube2c UTSW 2 164772562 makesense probably null
R5294:Ube2c UTSW 2 164777190 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTCAAGGATAAGTGGTCTGC -3'
(R):5'- TTCCAGAGTCCAGGGAAGGATC -3'

Sequencing Primer
(F):5'- GTCTGCACTATATGATGTCAGGAC -3'
(R):5'- CCAGGGAAGGATCAGGAGATATATTC -3'
Posted On2015-10-08