Incidental Mutation 'R4629:Saxo1'
ID349014
Institutional Source Beutler Lab
Gene Symbol Saxo1
Ensembl Gene ENSMUSG00000028492
Gene Namestabilizer of axonemal microtubules 1
Synonyms4930500O09Rik, Fam154a
MMRRC Submission 041894-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R4629 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location86444641-86558328 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86487827 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 45 (Y45C)
Ref Sequence ENSEMBL: ENSMUSP00000030216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030216]
Predicted Effect probably damaging
Transcript: ENSMUST00000030216
AA Change: Y45C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030216
Gene: ENSMUSG00000028492
AA Change: Y45C

DomainStartEndE-ValueType
Pfam:STOP 5 129 2.4e-13 PFAM
Pfam:STOP 88 265 1.6e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139694
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151481
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik T C 9: 114,279,351 noncoding transcript Het
Abca6 T C 11: 110,230,549 probably null Het
Adam22 A G 5: 8,232,663 S111P possibly damaging Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Alg10b C T 15: 90,227,745 A264V probably benign Het
Angpt1 T A 15: 42,438,400 Y404F probably benign Het
Apol7c A G 15: 77,526,395 F117S probably damaging Het
Asic5 T A 3: 82,006,504 Y162N probably damaging Het
Cacna2d2 A T 9: 107,527,322 E1104V probably damaging Het
Cad G A 5: 31,070,295 V1263I probably damaging Het
Cdc20 T C 4: 118,433,564 E413G probably damaging Het
Cfap46 A T 7: 139,680,927 L85Q probably damaging Het
Cnot6l A G 5: 96,077,211 V541A probably benign Het
Cubn T A 2: 13,313,979 probably null Het
Cx3cr1 T C 9: 120,051,664 N224S probably damaging Het
Fam98c T C 7: 29,155,268 T49A possibly damaging Het
Fez2 C T 17: 78,402,754 S202N probably benign Het
Fras1 A G 5: 96,776,734 N3678S probably benign Het
Glyr1 A G 16: 5,037,043 V57A possibly damaging Het
Gm5617 T A 9: 48,495,887 L107Q possibly damaging Het
Gpnmb A G 6: 49,051,060 D401G possibly damaging Het
Gtpbp6 C A 5: 110,106,908 V100L possibly damaging Het
Gucy1a1 A G 3: 82,097,624 V618A probably damaging Het
H6pd A T 4: 149,996,346 M14K probably benign Het
Hectd4 A G 5: 121,297,203 M993V probably benign Het
Kat14 A G 2: 144,404,220 probably benign Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Kera A G 10: 97,609,631 N284S probably benign Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lama1 A G 17: 67,805,360 probably null Het
Lgr6 T C 1: 135,104,932 Y70C probably damaging Het
Lipg T A 18: 74,948,036 K325* probably null Het
Lrrc43 T C 5: 123,499,520 L250P probably damaging Het
Lyz1 C T 10: 117,291,136 R65H probably benign Het
March10 T A 11: 105,389,838 L540F probably benign Het
Maz G T 7: 127,025,347 H334N possibly damaging Het
Myh1 A G 11: 67,209,293 K646R probably benign Het
Nf2 A T 11: 4,848,915 V24E probably damaging Het
Nup210l T C 3: 90,167,875 S831P probably benign Het
Nup210l C T 3: 90,190,874 R1378* probably null Het
Olfr45 T A 7: 140,691,378 S158T probably benign Het
Orc5 G T 5: 22,548,005 F10L probably benign Het
Palb2 A C 7: 122,127,966 I227S possibly damaging Het
Pate3 A T 9: 35,646,157 C68S probably damaging Het
Pcdha12 T A 18: 37,021,873 N548K probably damaging Het
Prdm10 C T 9: 31,337,316 Q345* probably null Het
Ptx4 A T 17: 25,122,763 N71Y probably damaging Het
Rab42 C T 4: 132,303,237 R34Q probably benign Het
Rergl A G 6: 139,501,852 V8A probably damaging Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Rpia A G 6: 70,766,594 M291T possibly damaging Het
Rplp0 G A 5: 115,561,423 probably null Het
Rrp12 A T 19: 41,883,516 I443N probably benign Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Sec24a A T 11: 51,721,813 probably null Het
Setdb2 A G 14: 59,409,359 V585A probably benign Het
Sik1 T C 17: 31,849,607 E347G probably benign Het
Srbd1 T C 17: 86,120,672 T378A probably damaging Het
Tacr1 A G 6: 82,403,880 T91A probably benign Het
Tas2r135 T A 6: 42,406,226 M233K probably benign Het
Tfg A T 16: 56,712,676 M40K probably damaging Het
Tmem35b C T 4: 127,129,003 P133S probably benign Het
Tmtc2 A T 10: 105,303,650 S672T probably benign Het
Trpv3 A T 11: 73,281,789 K253N probably damaging Het
Ube2c A G 2: 164,772,173 N143S possibly damaging Het
Unc13a A G 8: 71,653,453 M669T possibly damaging Het
Vmn1r61 T A 7: 5,611,250 I22F probably benign Het
Vmn2r26 A T 6: 124,061,191 Q575L possibly damaging Het
Vmn2r81 A T 10: 79,267,442 E156D probably damaging Het
Vwa3a T A 7: 120,793,375 N812K probably benign Het
Wasl T C 6: 24,637,681 R71G probably damaging Het
Wdfy4 A T 14: 33,102,558 N1301K probably damaging Het
Zfp72 A G 13: 74,372,393 C189R probably damaging Het
Zfp827 G A 8: 79,060,382 R59Q probably damaging Het
Other mutations in Saxo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Saxo1 APN 4 86445572 missense probably damaging 1.00
IGL00563:Saxo1 APN 4 86445572 missense probably damaging 1.00
IGL01816:Saxo1 APN 4 86445614 missense probably benign 0.03
IGL02941:Saxo1 APN 4 86445584 missense probably damaging 1.00
IGL03139:Saxo1 APN 4 86487762 missense possibly damaging 0.49
R0498:Saxo1 UTSW 4 86478896 missense possibly damaging 0.78
R0522:Saxo1 UTSW 4 86445103 missense probably damaging 1.00
R1126:Saxo1 UTSW 4 86478987 missense probably benign 0.30
R2203:Saxo1 UTSW 4 86445761 missense probably damaging 1.00
R2261:Saxo1 UTSW 4 86478975 missense probably damaging 1.00
R2262:Saxo1 UTSW 4 86478975 missense probably damaging 1.00
R4017:Saxo1 UTSW 4 86557996 missense possibly damaging 0.82
R5199:Saxo1 UTSW 4 86487782 missense probably damaging 1.00
R5471:Saxo1 UTSW 4 86445724 missense probably damaging 1.00
R5626:Saxo1 UTSW 4 86445589 missense probably damaging 1.00
R5679:Saxo1 UTSW 4 86445035 missense possibly damaging 0.89
R5710:Saxo1 UTSW 4 86445035 missense possibly damaging 0.89
R5782:Saxo1 UTSW 4 86445807 missense probably damaging 0.96
R6900:Saxo1 UTSW 4 86445334 missense possibly damaging 0.94
R7035:Saxo1 UTSW 4 86445122 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTAGCATTAAGGCTCTGATGTTG -3'
(R):5'- GGCAAAAGCCAGTCTGCATC -3'

Sequencing Primer
(F):5'- GATGTTGAATTCCACACTGCACG -3'
(R):5'- CAGTCTGCATCACATTTTGGAGGAC -3'
Posted On2015-10-08