Incidental Mutation 'R4629:Adam22'
ID349019
Institutional Source Beutler Lab
Gene Symbol Adam22
Ensembl Gene ENSMUSG00000040537
Gene Namea disintegrin and metallopeptidase domain 22
Synonyms2900022I03Rik, MDC2
MMRRC Submission 041894-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4629 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location8072352-8368160 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8232663 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 111 (S111P)
Ref Sequence ENSEMBL: ENSMUSP00000111043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046838] [ENSMUST00000050166] [ENSMUST00000088744] [ENSMUST00000088761] [ENSMUST00000115385] [ENSMUST00000115386] [ENSMUST00000115388]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046838
AA Change: S111P

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049120
Gene: ENSMUSG00000040537
AA Change: S111P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 7e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 9.3e-9 PFAM
Pfam:Reprolysin 237 436 1.1e-58 PFAM
Pfam:Reprolysin_3 261 379 3e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 789 808 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000050166
AA Change: S111P

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000055000
Gene: ENSMUSG00000040537
AA Change: S111P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 7.6e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 1.1e-8 PFAM
Pfam:Reprolysin 237 436 1.1e-58 PFAM
Pfam:Reprolysin_3 261 379 3.4e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 824 839 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000088744
AA Change: S111P

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000086122
Gene: ENSMUSG00000040537
AA Change: S111P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 41 186 4.2e-29 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 1.2e-8 PFAM
Pfam:Reprolysin 237 436 2.9e-65 PFAM
Pfam:Reprolysin_3 261 378 9.2e-13 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 736 758 N/A INTRINSIC
low complexity region 785 800 N/A INTRINSIC
low complexity region 883 898 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000088761
AA Change: S111P

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000086139
Gene: ENSMUSG00000040537
AA Change: S111P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 8.1e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 1.2e-8 PFAM
Pfam:Reprolysin 237 436 1.1e-58 PFAM
Pfam:Reprolysin_3 261 379 3.6e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 789 808 N/A INTRINSIC
low complexity region 860 875 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115385
AA Change: S111P

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111043
Gene: ENSMUSG00000040537
AA Change: S111P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 40 186 5.2e-28 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin 237 333 2e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115386
AA Change: S111P

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000111044
Gene: ENSMUSG00000040537
AA Change: S111P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 3.4e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 5.1e-9 PFAM
Pfam:Reprolysin 237 436 5e-59 PFAM
Pfam:Reprolysin_3 261 379 1.6e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 850 870 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115388
AA Change: S111P

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111046
Gene: ENSMUSG00000040537
AA Change: S111P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 8e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 1.1e-8 PFAM
Pfam:Reprolysin 237 436 1.1e-58 PFAM
Pfam:Reprolysin_3 261 379 3.5e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 852 872 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138652
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. The protein encoded by this gene is believed to lack metalloproteinase activity due to the lack of a critical catalytic motif. Mice lacking the encoded protein exhibit severe ataxia, hypomyelination and premature death. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous mutant mice exhibit severe ataxia, die before weaning and have marked hypomyelination of the peripheral nerves. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik T C 9: 114,279,351 noncoding transcript Het
Abca6 T C 11: 110,230,549 probably null Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Alg10b C T 15: 90,227,745 A264V probably benign Het
Angpt1 T A 15: 42,438,400 Y404F probably benign Het
Apol7c A G 15: 77,526,395 F117S probably damaging Het
Asic5 T A 3: 82,006,504 Y162N probably damaging Het
Cacna2d2 A T 9: 107,527,322 E1104V probably damaging Het
Cad G A 5: 31,070,295 V1263I probably damaging Het
Cdc20 T C 4: 118,433,564 E413G probably damaging Het
Cfap46 A T 7: 139,680,927 L85Q probably damaging Het
Cnot6l A G 5: 96,077,211 V541A probably benign Het
Cubn T A 2: 13,313,979 probably null Het
Cx3cr1 T C 9: 120,051,664 N224S probably damaging Het
Fam98c T C 7: 29,155,268 T49A possibly damaging Het
Fez2 C T 17: 78,402,754 S202N probably benign Het
Fras1 A G 5: 96,776,734 N3678S probably benign Het
Glyr1 A G 16: 5,037,043 V57A possibly damaging Het
Gm5617 T A 9: 48,495,887 L107Q possibly damaging Het
Gpnmb A G 6: 49,051,060 D401G possibly damaging Het
Gtpbp6 C A 5: 110,106,908 V100L possibly damaging Het
Gucy1a1 A G 3: 82,097,624 V618A probably damaging Het
H6pd A T 4: 149,996,346 M14K probably benign Het
Hectd4 A G 5: 121,297,203 M993V probably benign Het
Kat14 A G 2: 144,404,220 probably benign Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Kera A G 10: 97,609,631 N284S probably benign Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lama1 A G 17: 67,805,360 probably null Het
Lgr6 T C 1: 135,104,932 Y70C probably damaging Het
Lipg T A 18: 74,948,036 K325* probably null Het
Lrrc43 T C 5: 123,499,520 L250P probably damaging Het
Lyz1 C T 10: 117,291,136 R65H probably benign Het
March10 T A 11: 105,389,838 L540F probably benign Het
Maz G T 7: 127,025,347 H334N possibly damaging Het
Myh1 A G 11: 67,209,293 K646R probably benign Het
Nf2 A T 11: 4,848,915 V24E probably damaging Het
Nup210l T C 3: 90,167,875 S831P probably benign Het
Nup210l C T 3: 90,190,874 R1378* probably null Het
Olfr45 T A 7: 140,691,378 S158T probably benign Het
Orc5 G T 5: 22,548,005 F10L probably benign Het
Palb2 A C 7: 122,127,966 I227S possibly damaging Het
Pate3 A T 9: 35,646,157 C68S probably damaging Het
Pcdha12 T A 18: 37,021,873 N548K probably damaging Het
Prdm10 C T 9: 31,337,316 Q345* probably null Het
Ptx4 A T 17: 25,122,763 N71Y probably damaging Het
Rab42 C T 4: 132,303,237 R34Q probably benign Het
Rergl A G 6: 139,501,852 V8A probably damaging Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Rpia A G 6: 70,766,594 M291T possibly damaging Het
Rplp0 G A 5: 115,561,423 probably null Het
Rrp12 A T 19: 41,883,516 I443N probably benign Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Saxo1 T C 4: 86,487,827 Y45C probably damaging Het
Sec24a A T 11: 51,721,813 probably null Het
Setdb2 A G 14: 59,409,359 V585A probably benign Het
Sik1 T C 17: 31,849,607 E347G probably benign Het
Srbd1 T C 17: 86,120,672 T378A probably damaging Het
Tacr1 A G 6: 82,403,880 T91A probably benign Het
Tas2r135 T A 6: 42,406,226 M233K probably benign Het
Tfg A T 16: 56,712,676 M40K probably damaging Het
Tmem35b C T 4: 127,129,003 P133S probably benign Het
Tmtc2 A T 10: 105,303,650 S672T probably benign Het
Trpv3 A T 11: 73,281,789 K253N probably damaging Het
Ube2c A G 2: 164,772,173 N143S possibly damaging Het
Unc13a A G 8: 71,653,453 M669T possibly damaging Het
Vmn1r61 T A 7: 5,611,250 I22F probably benign Het
Vmn2r26 A T 6: 124,061,191 Q575L possibly damaging Het
Vmn2r81 A T 10: 79,267,442 E156D probably damaging Het
Vwa3a T A 7: 120,793,375 N812K probably benign Het
Wasl T C 6: 24,637,681 R71G probably damaging Het
Wdfy4 A T 14: 33,102,558 N1301K probably damaging Het
Zfp72 A G 13: 74,372,393 C189R probably damaging Het
Zfp827 G A 8: 79,060,382 R59Q probably damaging Het
Other mutations in Adam22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Adam22 APN 5 8127333 missense probably benign 0.44
IGL01368:Adam22 APN 5 8127411 missense probably damaging 1.00
IGL01406:Adam22 APN 5 8130212 nonsense probably null
IGL01463:Adam22 APN 5 8092790 missense probably damaging 1.00
IGL01691:Adam22 APN 5 8092742 missense probably damaging 1.00
IGL01798:Adam22 APN 5 8232604 splice site probably null
IGL01975:Adam22 APN 5 8167396 missense probably damaging 1.00
IGL02076:Adam22 APN 5 8136900 missense probably damaging 1.00
IGL02170:Adam22 APN 5 8134845 missense probably benign
IGL02189:Adam22 APN 5 8330029 missense possibly damaging 0.91
IGL02859:Adam22 APN 5 8167375 missense probably damaging 1.00
IGL03189:Adam22 APN 5 8111897 nonsense probably null
IGL03326:Adam22 APN 5 8127421 missense probably damaging 1.00
IGL03329:Adam22 APN 5 8149210 missense possibly damaging 0.48
IGL03354:Adam22 APN 5 8158890 missense possibly damaging 0.82
IGL03394:Adam22 APN 5 8167379 missense probably benign 0.00
IGL03047:Adam22 UTSW 5 8082220 missense probably damaging 1.00
R0445:Adam22 UTSW 5 8180591 intron probably benign
R0486:Adam22 UTSW 5 8330048 missense probably damaging 1.00
R0669:Adam22 UTSW 5 8143036 splice site probably benign
R0866:Adam22 UTSW 5 8082156 missense probably damaging 0.98
R1510:Adam22 UTSW 5 8152408 missense probably benign 0.06
R1562:Adam22 UTSW 5 8095007 missense probably damaging 1.00
R1640:Adam22 UTSW 5 8145689 missense probably damaging 1.00
R1903:Adam22 UTSW 5 8134525 missense probably damaging 1.00
R1939:Adam22 UTSW 5 8330015 missense probably damaging 1.00
R1998:Adam22 UTSW 5 8329995 missense probably damaging 1.00
R2012:Adam22 UTSW 5 8117634 missense probably damaging 1.00
R2214:Adam22 UTSW 5 8136805 critical splice donor site probably null
R2270:Adam22 UTSW 5 8121108 missense probably damaging 0.98
R2271:Adam22 UTSW 5 8121108 missense probably damaging 0.98
R2286:Adam22 UTSW 5 8145616 missense probably damaging 1.00
R2304:Adam22 UTSW 5 8092366 missense probably damaging 1.00
R2406:Adam22 UTSW 5 8180064 intron probably benign
R2656:Adam22 UTSW 5 8117696 missense probably damaging 1.00
R3106:Adam22 UTSW 5 8117583 splice site probably null
R3870:Adam22 UTSW 5 8132418 missense probably damaging 1.00
R3923:Adam22 UTSW 5 8130514 missense possibly damaging 0.68
R4092:Adam22 UTSW 5 8095004 missense probably damaging 1.00
R4180:Adam22 UTSW 5 8149218 missense probably damaging 1.00
R4247:Adam22 UTSW 5 8145626 missense probably benign
R4486:Adam22 UTSW 5 8180227 intron probably benign
R4744:Adam22 UTSW 5 8078699 missense probably damaging 0.98
R4839:Adam22 UTSW 5 8136813 missense probably damaging 1.00
R5007:Adam22 UTSW 5 8167393 missense probably damaging 1.00
R5030:Adam22 UTSW 5 8179645 intron probably benign
R5061:Adam22 UTSW 5 8180238 intron probably benign
R5312:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5353:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5354:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5356:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5423:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5424:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5719:Adam22 UTSW 5 8367217 missense probably benign
R5763:Adam22 UTSW 5 8134544 missense probably damaging 1.00
R5768:Adam22 UTSW 5 8127426 missense probably benign 0.35
R5776:Adam22 UTSW 5 8127361 missense probably benign 0.26
R5839:Adam22 UTSW 5 8136861 missense probably damaging 0.99
R6314:Adam22 UTSW 5 8127365 nonsense probably null
R6520:Adam22 UTSW 5 8116635 missense probably damaging 0.98
R6798:Adam22 UTSW 5 8160784 missense probably damaging 1.00
R6924:Adam22 UTSW 5 8367322 missense possibly damaging 0.78
R6938:Adam22 UTSW 5 8146499 missense probably benign 0.01
X0067:Adam22 UTSW 5 8127329 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CACTTGATTGTAACTGAGCAGAGTC -3'
(R):5'- GCGATACTGTGAAGTTGATGCAAG -3'

Sequencing Primer
(F):5'- AGGCATTCATTGAGTCAGGTAC -3'
(R):5'- ACTGTGAAGTTGATGCAAGTTTTC -3'
Posted On2015-10-08