Incidental Mutation 'R4629:Orc5'
ID349020
Institutional Source Beutler Lab
Gene Symbol Orc5
Ensembl Gene ENSMUSG00000029012
Gene Nameorigin recognition complex, subunit 5
SynonymsMmORC5, mouse origin recognition complex 5, Orc5l
MMRRC Submission 041894-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.938) question?
Stock #R4629 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location22486485-22550429 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 22548005 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 10 (F10L)
Ref Sequence ENSEMBL: ENSMUSP00000120214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030872] [ENSMUST00000141263]
Predicted Effect probably benign
Transcript: ENSMUST00000030872
AA Change: F28L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030872
Gene: ENSMUSG00000029012
AA Change: F28L

DomainStartEndE-ValueType
Pfam:AAA_16 7 155 2.4e-15 PFAM
Pfam:AAA_22 28 160 2.9e-9 PFAM
Pfam:ORC5_C 177 431 5.1e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138248
Predicted Effect probably benign
Transcript: ENSMUST00000141263
AA Change: F10L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120214
Gene: ENSMUSG00000029012
AA Change: F10L

DomainStartEndE-ValueType
Pfam:AAA_16 3 137 2.6e-9 PFAM
Pfam:AAA_22 11 144 1.1e-9 PFAM
Pfam:ORC5_C 159 312 2.7e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181764
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195898
Meta Mutation Damage Score 0.0956 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunit protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. The protein encoded by this gene is a subunit of the ORC complex. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik T C 9: 114,279,351 noncoding transcript Het
Abca6 T C 11: 110,230,549 probably null Het
Adam22 A G 5: 8,232,663 S111P possibly damaging Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Alg10b C T 15: 90,227,745 A264V probably benign Het
Angpt1 T A 15: 42,438,400 Y404F probably benign Het
Apol7c A G 15: 77,526,395 F117S probably damaging Het
Asic5 T A 3: 82,006,504 Y162N probably damaging Het
Cacna2d2 A T 9: 107,527,322 E1104V probably damaging Het
Cad G A 5: 31,070,295 V1263I probably damaging Het
Cdc20 T C 4: 118,433,564 E413G probably damaging Het
Cfap46 A T 7: 139,680,927 L85Q probably damaging Het
Cnot6l A G 5: 96,077,211 V541A probably benign Het
Cubn T A 2: 13,313,979 probably null Het
Cx3cr1 T C 9: 120,051,664 N224S probably damaging Het
Fam98c T C 7: 29,155,268 T49A possibly damaging Het
Fez2 C T 17: 78,402,754 S202N probably benign Het
Fras1 A G 5: 96,776,734 N3678S probably benign Het
Glyr1 A G 16: 5,037,043 V57A possibly damaging Het
Gm5617 T A 9: 48,495,887 L107Q possibly damaging Het
Gpnmb A G 6: 49,051,060 D401G possibly damaging Het
Gtpbp6 C A 5: 110,106,908 V100L possibly damaging Het
Gucy1a1 A G 3: 82,097,624 V618A probably damaging Het
H6pd A T 4: 149,996,346 M14K probably benign Het
Hectd4 A G 5: 121,297,203 M993V probably benign Het
Kat14 A G 2: 144,404,220 probably benign Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Kera A G 10: 97,609,631 N284S probably benign Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lama1 A G 17: 67,805,360 probably null Het
Lgr6 T C 1: 135,104,932 Y70C probably damaging Het
Lipg T A 18: 74,948,036 K325* probably null Het
Lrrc43 T C 5: 123,499,520 L250P probably damaging Het
Lyz1 C T 10: 117,291,136 R65H probably benign Het
March10 T A 11: 105,389,838 L540F probably benign Het
Maz G T 7: 127,025,347 H334N possibly damaging Het
Myh1 A G 11: 67,209,293 K646R probably benign Het
Nf2 A T 11: 4,848,915 V24E probably damaging Het
Nup210l T C 3: 90,167,875 S831P probably benign Het
Nup210l C T 3: 90,190,874 R1378* probably null Het
Olfr45 T A 7: 140,691,378 S158T probably benign Het
Palb2 A C 7: 122,127,966 I227S possibly damaging Het
Pate3 A T 9: 35,646,157 C68S probably damaging Het
Pcdha12 T A 18: 37,021,873 N548K probably damaging Het
Prdm10 C T 9: 31,337,316 Q345* probably null Het
Ptx4 A T 17: 25,122,763 N71Y probably damaging Het
Rab42 C T 4: 132,303,237 R34Q probably benign Het
Rergl A G 6: 139,501,852 V8A probably damaging Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Rpia A G 6: 70,766,594 M291T possibly damaging Het
Rplp0 G A 5: 115,561,423 probably null Het
Rrp12 A T 19: 41,883,516 I443N probably benign Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Saxo1 T C 4: 86,487,827 Y45C probably damaging Het
Sec24a A T 11: 51,721,813 probably null Het
Setdb2 A G 14: 59,409,359 V585A probably benign Het
Sik1 T C 17: 31,849,607 E347G probably benign Het
Srbd1 T C 17: 86,120,672 T378A probably damaging Het
Tacr1 A G 6: 82,403,880 T91A probably benign Het
Tas2r135 T A 6: 42,406,226 M233K probably benign Het
Tfg A T 16: 56,712,676 M40K probably damaging Het
Tmem35b C T 4: 127,129,003 P133S probably benign Het
Tmtc2 A T 10: 105,303,650 S672T probably benign Het
Trpv3 A T 11: 73,281,789 K253N probably damaging Het
Ube2c A G 2: 164,772,173 N143S possibly damaging Het
Unc13a A G 8: 71,653,453 M669T possibly damaging Het
Vmn1r61 T A 7: 5,611,250 I22F probably benign Het
Vmn2r26 A T 6: 124,061,191 Q575L possibly damaging Het
Vmn2r81 A T 10: 79,267,442 E156D probably damaging Het
Vwa3a T A 7: 120,793,375 N812K probably benign Het
Wasl T C 6: 24,637,681 R71G probably damaging Het
Wdfy4 A T 14: 33,102,558 N1301K probably damaging Het
Zfp72 A G 13: 74,372,393 C189R probably damaging Het
Zfp827 G A 8: 79,060,382 R59Q probably damaging Het
Other mutations in Orc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Orc5 APN 5 22523539 missense probably damaging 0.99
IGL00488:Orc5 APN 5 22516773 missense probably damaging 0.99
IGL01915:Orc5 APN 5 22522383 unclassified probably benign
IGL02385:Orc5 APN 5 22526440 missense probably damaging 1.00
IGL02830:Orc5 APN 5 22529267 missense probably damaging 1.00
IGL03128:Orc5 APN 5 22516773 missense probably damaging 0.99
R0372:Orc5 UTSW 5 22533784 missense possibly damaging 0.91
R0446:Orc5 UTSW 5 22546457 missense probably benign 0.19
R2060:Orc5 UTSW 5 22516703 critical splice donor site probably null
R2144:Orc5 UTSW 5 22547927 missense possibly damaging 0.94
R2375:Orc5 UTSW 5 22546552 missense probably damaging 1.00
R3875:Orc5 UTSW 5 22537566 missense probably benign 0.00
R4620:Orc5 UTSW 5 22529176 missense probably damaging 1.00
R4625:Orc5 UTSW 5 22548005 missense probably benign
R4626:Orc5 UTSW 5 22548005 missense probably benign
R4627:Orc5 UTSW 5 22548005 missense probably benign
R4664:Orc5 UTSW 5 22546522 missense probably benign
R5751:Orc5 UTSW 5 22499971 splice site probably null
R5758:Orc5 UTSW 5 22529258 missense possibly damaging 0.81
R7013:Orc5 UTSW 5 22533789 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GCACTGGGTGGTGAAATAAATTGTC -3'
(R):5'- AGGGGACACACGTTGAGTTG -3'

Sequencing Primer
(F):5'- GGTGGTGAAATAAATTGTCTCGATTC -3'
(R):5'- TTTAATCCCAGCACTCGGGAG -3'
Posted On2015-10-08