Incidental Mutation 'R0266:Sptlc3'
ID34904
Institutional Source Beutler Lab
Gene Symbol Sptlc3
Ensembl Gene ENSMUSG00000039092
Gene Nameserine palmitoyltransferase, long chain base subunit 3
Synonyms
MMRRC Submission 038492-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R0266 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location139493913-139637674 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 139596037 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 417 (I417K)
Ref Sequence ENSEMBL: ENSMUSP00000105710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047370] [ENSMUST00000110083]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047370
AA Change: I417K

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000048313
Gene: ENSMUSG00000039092
AA Change: I417K

DomainStartEndE-ValueType
transmembrane domain 60 79 N/A INTRINSIC
Pfam:Aminotran_1_2 160 520 4.8e-59 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110083
AA Change: I417K

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105710
Gene: ENSMUSG00000039092
AA Change: I417K

DomainStartEndE-ValueType
transmembrane domain 60 79 N/A INTRINSIC
Pfam:Aminotran_1_2 160 520 4.8e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134801
Meta Mutation Damage Score 0.0608 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.2%
  • 10x: 94.9%
  • 20x: 89.8%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The SPTLC3 gene encodes an isoform of the third subunit of serine palmitoyltransferase (SPT; EC 2.3.1.50), which catalyzes the rate-limiting step of the de novo synthesis of sphingolipids (Hornemann et al., 2006 [PubMed 17023427]). SPT contains 2 main subunits: the common SPTLC1 subunit (MIM 605712) and either SPTLC2 (MIM 605713) or its isoform SPTLC2L (SPTLC3), depending on the tissue in which biosynthesis occurs (Hornemann et al., 2006 [PubMed 17023427]). There are also 2 highly related isoforms of a third subunit, SSSPTA (MIM 613540) and SSSPTB (MIM 610412), that confer acyl-CoA preference of the SPT enzyme and are essential for maximal enzyme activity (Han et al., 2009 [PubMed 19416851]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik A G 12: 110,668,754 S117P possibly damaging Het
Aars2 T C 17: 45,507,510 probably benign Het
Acot11 T C 4: 106,749,988 D466G probably damaging Het
Adgrd1 G A 5: 129,139,594 A342T probably benign Het
Apbb2 A T 5: 66,302,611 N714K probably benign Het
Aqp12 C A 1: 93,006,850 H150N possibly damaging Het
Brinp3 T A 1: 146,682,680 L114* probably null Het
Ccng2 T C 5: 93,271,289 probably benign Het
Cd36 T A 5: 17,798,252 R265S probably benign Het
Ces4a T C 8: 105,141,966 L104S probably benign Het
Clca4b T C 3: 144,922,786 I387V probably damaging Het
Cul7 T A 17: 46,654,595 H566Q probably benign Het
Ddx60 A T 8: 62,033,493 H1646L possibly damaging Het
Dntt T C 19: 41,059,127 I503T probably damaging Het
Dynlt1a T G 17: 6,317,395 E2D probably benign Het
Efemp2 G T 19: 5,477,999 C78F probably damaging Het
Esco1 T C 18: 10,594,605 E227G probably benign Het
Fezf2 T A 14: 12,342,607 K419N probably damaging Het
Gm17541 A T 12: 4,689,487 probably benign Het
Gm2381 G A 7: 42,819,948 Q251* probably null Het
Gm4782 T G 6: 50,610,694 S686R probably damaging Het
Grin3a G A 4: 49,665,501 R1045* probably null Het
Grm8 T C 6: 27,285,896 Y839C probably damaging Het
Gtf3c1 G A 7: 125,644,134 P1766L possibly damaging Het
Herc2 T A 7: 56,206,578 H3921Q probably damaging Het
Hes6 A T 1: 91,412,304 D143E possibly damaging Het
Hmcn2 A G 2: 31,394,827 E2055G probably benign Het
Hmcn2 G A 2: 31,445,353 probably benign Het
Ikzf3 A G 11: 98,467,317 L398P probably benign Het
Il10ra A T 9: 45,265,652 I125N probably benign Het
Kcnb2 G A 1: 15,712,913 probably benign Het
Krt77 T C 15: 101,869,378 R81G possibly damaging Het
Lrrc40 T A 3: 158,041,661 probably null Het
Man1a2 C T 3: 100,582,034 R543Q probably damaging Het
Mansc1 T C 6: 134,610,707 D169G probably benign Het
Mdn1 T A 4: 32,741,835 S3869T probably damaging Het
Mettl14 A T 3: 123,382,826 S58T probably benign Het
Mrpl4 T C 9: 21,003,314 V62A probably benign Het
Myh3 A G 11: 67,093,672 D1085G possibly damaging Het
Myo5c C A 9: 75,284,216 probably benign Het
Naalad2 G T 9: 18,350,943 probably benign Het
Nat3 A G 8: 67,547,780 T104A probably benign Het
Nek4 A G 14: 30,957,296 E198G probably damaging Het
Olfm1 A G 2: 28,229,607 Y403C probably damaging Het
Olfr1131 C A 2: 87,629,282 T273K possibly damaging Het
Olfr873 A T 9: 20,301,158 R320S probably benign Het
Osbpl1a T A 18: 12,871,163 probably null Het
Pax7 G A 4: 139,779,736 S330L possibly damaging Het
Pcdhb15 C A 18: 37,475,276 D520E probably damaging Het
Pgm3 T C 9: 86,567,533 T145A probably benign Het
Phox2b G A 5: 67,096,625 probably null Het
Pik3r6 A T 11: 68,526,408 R59* probably null Het
Pold1 A G 7: 44,541,025 probably benign Het
Ppp1r21 T C 17: 88,569,072 probably benign Het
Prl5a1 A G 13: 28,149,987 K158E possibly damaging Het
Rag2 T G 2: 101,630,603 C419W probably damaging Het
Reln A G 5: 21,988,776 S1395P probably damaging Het
Retnlb T G 16: 48,818,659 Y74* probably null Het
Robo3 A G 9: 37,422,640 S633P probably damaging Het
Ryr1 A G 7: 29,040,679 S3941P probably damaging Het
Scnn1b A G 7: 121,912,475 N370S probably damaging Het
Slc6a5 C A 7: 49,938,408 probably benign Het
Sort1 T A 3: 108,344,931 N481K probably benign Het
Svil T A 18: 5,099,063 probably benign Het
Taf4b T C 18: 14,813,077 probably benign Het
Tchp T C 5: 114,709,333 M71T possibly damaging Het
Thsd4 T A 9: 59,997,134 H233L probably benign Het
Tmem217 G T 17: 29,526,599 N52K possibly damaging Het
Tmem38b T C 4: 53,840,765 L60S probably damaging Het
Uqcrfs1 A C 13: 30,541,163 N131K probably benign Het
Vars T A 17: 35,013,869 S896R probably benign Het
Vmn1r170 A T 7: 23,606,481 M103L probably benign Het
Vmn2r22 T C 6: 123,637,404 Y409C probably damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Wdr49 A T 3: 75,451,796 I8N possibly damaging Het
Zfp648 T A 1: 154,204,886 Y264N probably damaging Het
Zmym1 A C 4: 127,048,025 F857V possibly damaging Het
Other mutations in Sptlc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Sptlc3 APN 2 139546421 missense possibly damaging 0.55
IGL01537:Sptlc3 APN 2 139589695 missense possibly damaging 0.95
IGL01996:Sptlc3 APN 2 139581504 splice site probably benign
IGL02512:Sptlc3 APN 2 139547203 missense probably damaging 1.00
IGL03278:Sptlc3 APN 2 139589659 missense probably damaging 1.00
IGL03286:Sptlc3 APN 2 139589659 missense probably damaging 1.00
R0362:Sptlc3 UTSW 2 139546555 splice site probably benign
R1464:Sptlc3 UTSW 2 139547234 missense probably benign 0.00
R1464:Sptlc3 UTSW 2 139547234 missense probably benign 0.00
R1494:Sptlc3 UTSW 2 139589560 missense possibly damaging 0.58
R1847:Sptlc3 UTSW 2 139625923 missense probably benign 0.08
R1919:Sptlc3 UTSW 2 139566675 missense possibly damaging 0.66
R2093:Sptlc3 UTSW 2 139625874 missense possibly damaging 0.89
R2396:Sptlc3 UTSW 2 139566586 missense probably benign 0.44
R2972:Sptlc3 UTSW 2 139589661 missense probably damaging 1.00
R2973:Sptlc3 UTSW 2 139589661 missense probably damaging 1.00
R2974:Sptlc3 UTSW 2 139589661 missense probably damaging 1.00
R4601:Sptlc3 UTSW 2 139636680 missense probably benign 0.01
R4602:Sptlc3 UTSW 2 139636680 missense probably benign 0.01
R4610:Sptlc3 UTSW 2 139636680 missense probably benign 0.01
R4745:Sptlc3 UTSW 2 139547167 missense probably damaging 1.00
R4779:Sptlc3 UTSW 2 139589589 missense probably benign 0.04
R4992:Sptlc3 UTSW 2 139596003 missense probably benign 0.04
R5162:Sptlc3 UTSW 2 139631343 missense probably benign 0.11
R5401:Sptlc3 UTSW 2 139636723 missense possibly damaging 0.75
R5406:Sptlc3 UTSW 2 139546478 missense probably benign 0.26
R5642:Sptlc3 UTSW 2 139546408 missense probably damaging 0.96
R5840:Sptlc3 UTSW 2 139547206 missense probably damaging 1.00
R6057:Sptlc3 UTSW 2 139581613 missense probably damaging 0.99
R6376:Sptlc3 UTSW 2 139636772 missense probably benign 0.21
R6852:Sptlc3 UTSW 2 139566586 missense probably benign 0.44
R7026:Sptlc3 UTSW 2 139537688 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTCATGTACAAAGGACAAGCTCTGAAA -3'
(R):5'- ACGGACAGCAAGCAAGCATATACATAT -3'

Sequencing Primer
(F):5'- GGACAAGCTCTGAAAATTGTTTGC -3'
(R):5'- agtggtggtggtggtgg -3'
Posted On2013-05-09