Incidental Mutation 'R4629:Unc13a'
ID349048
Institutional Source Beutler Lab
Gene Symbol Unc13a
Ensembl Gene ENSMUSG00000034799
Gene Nameunc-13 homolog A (C. elegans)
Synonyms2410078G03Rik, Munc13-1
MMRRC Submission 041894-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4629 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location71624417-71671757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71653453 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 669 (M669T)
Ref Sequence ENSEMBL: ENSMUSP00000030170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030170] [ENSMUST00000177517]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030170
AA Change: M669T

PolyPhen 2 Score 0.654 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000030170
Gene: ENSMUSG00000034799
AA Change: M669T

DomainStartEndE-ValueType
C2 3 94 5.23e-10 SMART
low complexity region 187 202 N/A INTRINSIC
low complexity region 264 277 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
coiled coil region 321 359 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 435 450 N/A INTRINSIC
PDB:2KDU|B 454 488 3e-16 PDB
C1 563 612 3.93e-18 SMART
C2 686 793 5.86e-22 SMART
DUF1041 1002 1111 1.6e-56 SMART
Pfam:Membr_traf_MHD 1355 1520 6.3e-53 PFAM
C2 1555 1661 5.03e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176426
Predicted Effect probably benign
Transcript: ENSMUST00000177517
AA Change: M669T

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000135189
Gene: ENSMUSG00000034799
AA Change: M669T

DomainStartEndE-ValueType
C2 3 94 5.23e-10 SMART
low complexity region 187 202 N/A INTRINSIC
low complexity region 264 277 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
coiled coil region 321 359 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 435 450 N/A INTRINSIC
PDB:2KDU|B 454 488 3e-16 PDB
C1 563 612 3.93e-18 SMART
C2 686 793 5.86e-22 SMART
DUF1041 1002 1111 1.6e-56 SMART
Pfam:Membr_traf_MHD 1355 1520 6.7e-53 PFAM
C2 1574 1680 5.03e-12 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the UNC13 family. UNC13 proteins bind to phorbol esters and diacylglycerol and play important roles in neurotransmitter release at synapses. Single nucleotide polymorphisms in this gene may be associated with sporadic amyotrophic lateral sclerosis. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutant mice do not feed and die within hours of birth and synaptic vesicle maturation is impaired. Mice homozygous for a knock-in allele exhibit slower rate of synaptic vesicle replenishment, aberrant short-term depression and reduced recoveryfrom synaptic depression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik T C 9: 114,279,351 noncoding transcript Het
Abca6 T C 11: 110,230,549 probably null Het
Adam22 A G 5: 8,232,663 S111P possibly damaging Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Alg10b C T 15: 90,227,745 A264V probably benign Het
Angpt1 T A 15: 42,438,400 Y404F probably benign Het
Apol7c A G 15: 77,526,395 F117S probably damaging Het
Asic5 T A 3: 82,006,504 Y162N probably damaging Het
Cacna2d2 A T 9: 107,527,322 E1104V probably damaging Het
Cad G A 5: 31,070,295 V1263I probably damaging Het
Cdc20 T C 4: 118,433,564 E413G probably damaging Het
Cfap46 A T 7: 139,680,927 L85Q probably damaging Het
Cnot6l A G 5: 96,077,211 V541A probably benign Het
Cubn T A 2: 13,313,979 probably null Het
Cx3cr1 T C 9: 120,051,664 N224S probably damaging Het
Fam98c T C 7: 29,155,268 T49A possibly damaging Het
Fez2 C T 17: 78,402,754 S202N probably benign Het
Fras1 A G 5: 96,776,734 N3678S probably benign Het
Glyr1 A G 16: 5,037,043 V57A possibly damaging Het
Gm5617 T A 9: 48,495,887 L107Q possibly damaging Het
Gpnmb A G 6: 49,051,060 D401G possibly damaging Het
Gtpbp6 C A 5: 110,106,908 V100L possibly damaging Het
Gucy1a1 A G 3: 82,097,624 V618A probably damaging Het
H6pd A T 4: 149,996,346 M14K probably benign Het
Hectd4 A G 5: 121,297,203 M993V probably benign Het
Kat14 A G 2: 144,404,220 probably benign Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Kera A G 10: 97,609,631 N284S probably benign Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lama1 A G 17: 67,805,360 probably null Het
Lgr6 T C 1: 135,104,932 Y70C probably damaging Het
Lipg T A 18: 74,948,036 K325* probably null Het
Lrrc43 T C 5: 123,499,520 L250P probably damaging Het
Lyz1 C T 10: 117,291,136 R65H probably benign Het
March10 T A 11: 105,389,838 L540F probably benign Het
Maz G T 7: 127,025,347 H334N possibly damaging Het
Myh1 A G 11: 67,209,293 K646R probably benign Het
Nf2 A T 11: 4,848,915 V24E probably damaging Het
Nup210l T C 3: 90,167,875 S831P probably benign Het
Nup210l C T 3: 90,190,874 R1378* probably null Het
Olfr45 T A 7: 140,691,378 S158T probably benign Het
Orc5 G T 5: 22,548,005 F10L probably benign Het
Palb2 A C 7: 122,127,966 I227S possibly damaging Het
Pate3 A T 9: 35,646,157 C68S probably damaging Het
Pcdha12 T A 18: 37,021,873 N548K probably damaging Het
Prdm10 C T 9: 31,337,316 Q345* probably null Het
Ptx4 A T 17: 25,122,763 N71Y probably damaging Het
Rab42 C T 4: 132,303,237 R34Q probably benign Het
Rergl A G 6: 139,501,852 V8A probably damaging Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Rpia A G 6: 70,766,594 M291T possibly damaging Het
Rplp0 G A 5: 115,561,423 probably null Het
Rrp12 A T 19: 41,883,516 I443N probably benign Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Saxo1 T C 4: 86,487,827 Y45C probably damaging Het
Sec24a A T 11: 51,721,813 probably null Het
Setdb2 A G 14: 59,409,359 V585A probably benign Het
Sik1 T C 17: 31,849,607 E347G probably benign Het
Srbd1 T C 17: 86,120,672 T378A probably damaging Het
Tacr1 A G 6: 82,403,880 T91A probably benign Het
Tas2r135 T A 6: 42,406,226 M233K probably benign Het
Tfg A T 16: 56,712,676 M40K probably damaging Het
Tmem35b C T 4: 127,129,003 P133S probably benign Het
Tmtc2 A T 10: 105,303,650 S672T probably benign Het
Trpv3 A T 11: 73,281,789 K253N probably damaging Het
Ube2c A G 2: 164,772,173 N143S possibly damaging Het
Vmn1r61 T A 7: 5,611,250 I22F probably benign Het
Vmn2r26 A T 6: 124,061,191 Q575L possibly damaging Het
Vmn2r81 A T 10: 79,267,442 E156D probably damaging Het
Vwa3a T A 7: 120,793,375 N812K probably benign Het
Wasl T C 6: 24,637,681 R71G probably damaging Het
Wdfy4 A T 14: 33,102,558 N1301K probably damaging Het
Zfp72 A G 13: 74,372,393 C189R probably damaging Het
Zfp827 G A 8: 79,060,382 R59Q probably damaging Het
Other mutations in Unc13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Unc13a APN 8 71643147 missense probably null 0.70
IGL01023:Unc13a APN 8 71661825 missense probably benign 0.02
IGL01456:Unc13a APN 8 71644567 missense probably damaging 1.00
IGL01820:Unc13a APN 8 71654947 missense probably damaging 0.99
IGL01909:Unc13a APN 8 71639210 splice site probably benign
IGL01925:Unc13a APN 8 71634543 missense possibly damaging 0.95
IGL02407:Unc13a APN 8 71648942 missense probably damaging 0.99
IGL02622:Unc13a APN 8 71652514 splice site probably null
IGL02634:Unc13a APN 8 71655701 missense probably benign 0.03
IGL02724:Unc13a APN 8 71656305 splice site probably benign
IGL02892:Unc13a APN 8 71649910 missense probably damaging 1.00
IGL02948:Unc13a APN 8 71650549 missense possibly damaging 0.63
IGL03081:Unc13a APN 8 71649549 missense probably damaging 0.98
IGL03372:Unc13a APN 8 71655709 missense probably damaging 1.00
curvy UTSW 8 71630504 splice site probably null
greed UTSW 8 71654845 missense probably damaging 1.00
largesse UTSW 8 71634658 missense probably damaging 1.00
serpiginous UTSW 8 71664245 missense probably damaging 1.00
PIT4469001:Unc13a UTSW 8 71658314 nonsense probably null
R0067:Unc13a UTSW 8 71634658 missense probably damaging 1.00
R0067:Unc13a UTSW 8 71634658 missense probably damaging 1.00
R0389:Unc13a UTSW 8 71658032 missense probably benign 0.01
R0457:Unc13a UTSW 8 71658001 critical splice donor site probably null
R0478:Unc13a UTSW 8 71651148 missense possibly damaging 0.92
R0483:Unc13a UTSW 8 71644913 missense probably damaging 0.96
R0609:Unc13a UTSW 8 71658467 missense probably damaging 0.96
R0611:Unc13a UTSW 8 71649865 missense probably damaging 1.00
R0730:Unc13a UTSW 8 71656285 missense possibly damaging 0.68
R0883:Unc13a UTSW 8 71642173 nonsense probably null
R1162:Unc13a UTSW 8 71647917 missense probably benign 0.31
R1185:Unc13a UTSW 8 71661833 missense probably benign 0.13
R1185:Unc13a UTSW 8 71661833 missense probably benign 0.13
R1185:Unc13a UTSW 8 71661833 missense probably benign 0.13
R1196:Unc13a UTSW 8 71654986 missense probably damaging 1.00
R1400:Unc13a UTSW 8 71651221 missense probably damaging 1.00
R1446:Unc13a UTSW 8 71648981 missense possibly damaging 0.91
R1507:Unc13a UTSW 8 71658266 missense probably benign
R1636:Unc13a UTSW 8 71653390 missense probably damaging 1.00
R1858:Unc13a UTSW 8 71652399 missense probably damaging 1.00
R2025:Unc13a UTSW 8 71639768 missense possibly damaging 0.92
R2107:Unc13a UTSW 8 71656251 splice site probably null
R2286:Unc13a UTSW 8 71630559 missense probably damaging 1.00
R2334:Unc13a UTSW 8 71634558 missense probably damaging 1.00
R2924:Unc13a UTSW 8 71644952 missense possibly damaging 0.88
R3177:Unc13a UTSW 8 71629695 missense probably benign 0.01
R3277:Unc13a UTSW 8 71629695 missense probably benign 0.01
R4175:Unc13a UTSW 8 71667724 intron probably benign
R4279:Unc13a UTSW 8 71666667 missense probably damaging 0.98
R4803:Unc13a UTSW 8 71662850 splice site probably null
R4877:Unc13a UTSW 8 71658616 missense possibly damaging 0.85
R4927:Unc13a UTSW 8 71654845 missense probably damaging 1.00
R4930:Unc13a UTSW 8 71630504 splice site probably null
R4994:Unc13a UTSW 8 71643172 missense probably benign 0.28
R5011:Unc13a UTSW 8 71641477 nonsense probably null
R5252:Unc13a UTSW 8 71652564 missense probably damaging 1.00
R5356:Unc13a UTSW 8 71662514 missense probably benign 0.02
R5458:Unc13a UTSW 8 71664245 missense probably damaging 1.00
R5514:Unc13a UTSW 8 71643151 missense probably damaging 1.00
R5784:Unc13a UTSW 8 71655666 missense possibly damaging 0.61
R5853:Unc13a UTSW 8 71655129 splice site probably null
R6183:Unc13a UTSW 8 71644666 missense probably damaging 1.00
R6277:Unc13a UTSW 8 71666639 critical splice donor site probably null
R6374:Unc13a UTSW 8 71641453 missense possibly damaging 0.70
R6392:Unc13a UTSW 8 71637809 missense possibly damaging 0.83
R6515:Unc13a UTSW 8 71647940 missense probably benign 0.44
R6576:Unc13a UTSW 8 71653478 missense probably benign 0.00
R6943:Unc13a UTSW 8 71652377 missense probably damaging 1.00
R7045:Unc13a UTSW 8 71658763 missense possibly damaging 0.95
R7062:Unc13a UTSW 8 71663237 missense probably benign 0.00
R7146:Unc13a UTSW 8 71630553 missense probably damaging 1.00
R7260:Unc13a UTSW 8 71660585 missense possibly damaging 0.71
Z1088:Unc13a UTSW 8 71654803 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTCTCACATGCATGCTAGAGGC -3'
(R):5'- AATCCAGAGTAGCCTCAGAGG -3'

Sequencing Primer
(F):5'- TAGAGGCAGCTTCCCTGAG -3'
(R):5'- GGTCACTAAGGCCAAGTACATCTG -3'
Posted On2015-10-08