Incidental Mutation 'R4630:Jag1'
ID349095
Institutional Source Beutler Lab
Gene Symbol Jag1
Ensembl Gene ENSMUSG00000027276
Gene Namejagged 1
SynonymsABE2, Gsfabe2, Serrate-1, Htu, Ozz, Headturner
MMRRC Submission 041895-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4630 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location137081456-137116644 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 137085979 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 837 (D837E)
Ref Sequence ENSEMBL: ENSMUSP00000028735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028735]
Predicted Effect probably damaging
Transcript: ENSMUST00000028735
AA Change: D837E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028735
Gene: ENSMUSG00000027276
AA Change: D837E

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:MNNL 31 109 2.8e-31 PFAM
DSL 167 229 1.85e-37 SMART
EGF 233 263 1.66e1 SMART
EGF 264 294 2.25e1 SMART
EGF_CA 296 334 4.42e-7 SMART
EGF 339 372 2.64e-5 SMART
EGF_CA 374 410 2.89e-11 SMART
EGF_CA 412 448 2.8e-9 SMART
EGF_CA 450 485 2.31e-10 SMART
EGF_CA 487 523 1.69e-12 SMART
EGF_CA 525 561 4.19e-8 SMART
EGF 577 627 2.16e-1 SMART
EGF_CA 629 665 2.56e-12 SMART
EGF_CA 667 703 6.91e-9 SMART
EGF 708 741 5.88e-3 SMART
EGF 747 780 9.62e-8 SMART
EGF_CA 782 818 3.59e-7 SMART
EGF_CA 820 856 3.81e-11 SMART
VWC 863 930 4.79e-16 SMART
transmembrane domain 1069 1091 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133640
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The jagged 1 protein encoded by JAG1 is the human homolog of the Drosophilia jagged protein. Human jagged 1 is the ligand for the receptor notch 1, the latter a human homolog of the Drosophilia jagged receptor notch. Mutations that alter the jagged 1 protein cause Alagille syndrome. Jagged 1 signalling through notch 1 has also been shown to play a role in hematopoiesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit extensive hemorrhaging and die prior to embryonic day 11.5, while heterozygotes exhibit defects of the eye. Heterozygotes for missense mutations have inner ear abnormalities. Other mutant mice display abnormal head movements. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
3110001I22Rik T C 16: 13,677,414 S126P probably damaging Het
3110070M22Rik A T 13: 119,488,086 probably benign Het
4833423E24Rik C A 2: 85,518,646 G41* probably null Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
BC024139 T G 15: 76,125,094 Q240P probably benign Het
Bckdha A T 7: 25,631,459 I44N probably damaging Het
Brpf1 T C 6: 113,309,906 Y32H probably damaging Het
Catip A G 1: 74,368,913 probably benign Het
Ccdc138 T C 10: 58,573,655 L602P probably damaging Het
Cilp A T 9: 65,279,880 T1086S probably benign Het
Comp A T 8: 70,374,382 I58F possibly damaging Het
Crygs T C 16: 22,805,518 E113G possibly damaging Het
Dnmt3b C T 2: 153,670,315 R319* probably null Het
Eif3a A G 19: 60,769,928 I804T unknown Het
Eif3a A T 19: 60,777,986 H301Q probably benign Het
Elf3 A T 1: 135,256,740 probably benign Het
Gm10384 A G 15: 36,871,773 noncoding transcript Het
Gm11627 T A 11: 102,578,831 probably benign Het
Gpr183 A T 14: 121,954,849 Y87N probably damaging Het
Gpr183 G C 14: 121,954,850 Y86* probably null Het
Gpr26 T C 7: 131,966,980 V18A probably damaging Het
Herc1 T A 9: 66,433,714 probably null Het
Hint2 C T 4: 43,656,396 probably benign Het
Jmjd1c C A 10: 67,157,974 S78* probably null Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lalba T C 15: 98,482,668 M2V probably benign Het
Lama1 T A 17: 67,794,300 D1929E probably benign Het
Macf1 T C 4: 123,473,639 K878R possibly damaging Het
Mboat4 T C 8: 34,123,954 S182P probably damaging Het
Muc5b A T 7: 141,857,984 T1556S unknown Het
Myo1g T C 11: 6,519,047 Y85C probably damaging Het
Ncapd2 C A 6: 125,179,233 probably null Het
Nox3 T C 17: 3,693,982 D96G possibly damaging Het
Olfr23 T C 11: 73,940,996 L250P probably damaging Het
Olfr514 T C 7: 108,825,595 M135V probably damaging Het
Olfr805 A G 10: 129,723,481 L21P probably damaging Het
Pacs1 C T 19: 5,156,356 probably null Het
Pgm5 C A 19: 24,834,746 G141* probably null Het
Pik3r4 A G 9: 105,654,899 M557V probably benign Het
Pld4 T A 12: 112,765,064 V217D probably damaging Het
Ppp1r3c T C 19: 36,733,515 E285G probably benign Het
Pradc1 T A 6: 85,447,293 M24L possibly damaging Het
Prepl T C 17: 85,083,231 T100A probably benign Het
Rmi2 C T 16: 10,886,209 T138I probably benign Het
Rtkn A T 6: 83,152,182 K540* probably null Het
Sag C A 1: 87,834,618 T335K probably damaging Het
Setd4 A G 16: 93,591,226 L124P probably benign Het
Sh3gl2 A G 4: 85,379,409 D208G probably damaging Het
Sult4a1 T C 15: 84,105,578 T8A possibly damaging Het
Tert A G 13: 73,648,991 D1116G probably damaging Het
Tlr4 A G 4: 66,839,240 E90G probably benign Het
Tmem123 T C 9: 7,791,392 L164P probably damaging Het
Tmem246 C G 4: 49,586,254 V305L probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trak1 G A 9: 121,454,425 R419Q probably benign Het
Trp53bp1 G T 2: 121,207,887 A1490D probably damaging Het
Ttc16 T C 2: 32,775,377 probably benign Het
Tyw5 T A 1: 57,388,527 Q306L probably damaging Het
Ube2j2 T A 4: 155,955,258 I14N probably damaging Het
Vmn2r103 T C 17: 19,793,696 I250T probably benign Het
Zar1 A G 5: 72,580,906 V51A probably benign Het
Zbtb38 T G 9: 96,688,851 N60T probably damaging Het
Zfp354a T C 11: 51,070,218 S417P probably damaging Het
Zfp410 A T 12: 84,325,736 D112V probably damaging Het
Zfp518a C T 19: 40,912,979 Q451* probably null Het
Zfp64 T C 2: 168,926,543 N383S possibly damaging Het
Zfp687 A T 3: 95,012,488 probably null Het
Other mutations in Jag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Jag1 APN 2 137086032 critical splice acceptor site probably null
IGL00912:Jag1 APN 2 137115573 missense probably damaging 1.00
IGL01104:Jag1 APN 2 137084378 missense probably benign 0.40
IGL01529:Jag1 APN 2 137084977 missense probably damaging 0.99
IGL01578:Jag1 APN 2 137100051 splice site probably benign
IGL01720:Jag1 APN 2 137087103 missense probably damaging 1.00
IGL01809:Jag1 APN 2 137115484 missense probably damaging 1.00
IGL02402:Jag1 APN 2 137085938 missense possibly damaging 0.79
IGL02434:Jag1 APN 2 137087155 missense probably benign 0.01
IGL02543:Jag1 APN 2 137091947 splice site probably benign
IGL02650:Jag1 APN 2 137115585 missense possibly damaging 0.95
IGL03010:Jag1 APN 2 137093198 splice site probably benign
IGL03102:Jag1 APN 2 137084688 missense probably benign 0.00
Grenville UTSW 2 137087142 missense probably damaging 1.00
PIT4651001:Jag1 UTSW 2 137101697 missense probably damaging 1.00
R0227:Jag1 UTSW 2 137115618 missense probably benign
R0306:Jag1 UTSW 2 137085935 missense probably damaging 1.00
R0325:Jag1 UTSW 2 137095445 critical splice donor site probably null
R0594:Jag1 UTSW 2 137087080 missense probably damaging 0.99
R0838:Jag1 UTSW 2 137093278 missense probably damaging 0.98
R0879:Jag1 UTSW 2 137100081 missense possibly damaging 0.80
R0900:Jag1 UTSW 2 137090882 frame shift probably null
R0972:Jag1 UTSW 2 137083451 missense possibly damaging 0.64
R1083:Jag1 UTSW 2 137096232 missense probably damaging 0.99
R1182:Jag1 UTSW 2 137091489 missense probably benign 0.36
R1292:Jag1 UTSW 2 137083473 missense possibly damaging 0.79
R1464:Jag1 UTSW 2 137115648 missense probably damaging 0.98
R1464:Jag1 UTSW 2 137115648 missense probably damaging 0.98
R1500:Jag1 UTSW 2 137115638 missense possibly damaging 0.82
R1936:Jag1 UTSW 2 137083473 missense possibly damaging 0.79
R1937:Jag1 UTSW 2 137083473 missense possibly damaging 0.79
R1939:Jag1 UTSW 2 137083473 missense possibly damaging 0.79
R1998:Jag1 UTSW 2 137090938 missense probably damaging 1.00
R2019:Jag1 UTSW 2 137084679 missense probably benign 0.37
R2213:Jag1 UTSW 2 137089892 missense probably benign 0.01
R2300:Jag1 UTSW 2 137096315 missense probably damaging 1.00
R2484:Jag1 UTSW 2 137084700 missense possibly damaging 0.86
R4179:Jag1 UTSW 2 137101658 missense probably damaging 0.99
R4212:Jag1 UTSW 2 137085070 missense probably benign
R4701:Jag1 UTSW 2 137094456 missense probably benign 0.11
R4705:Jag1 UTSW 2 137096309 missense probably damaging 1.00
R4904:Jag1 UTSW 2 137087142 missense probably damaging 1.00
R5050:Jag1 UTSW 2 137085154 missense possibly damaging 0.71
R5288:Jag1 UTSW 2 137095544 missense possibly damaging 0.75
R5367:Jag1 UTSW 2 137085094 missense possibly damaging 0.90
R5385:Jag1 UTSW 2 137095544 missense possibly damaging 0.75
R5386:Jag1 UTSW 2 137095544 missense possibly damaging 0.75
R5430:Jag1 UTSW 2 137101706 missense possibly damaging 0.94
R5472:Jag1 UTSW 2 137084995 missense probably damaging 1.00
R5755:Jag1 UTSW 2 137088690 missense probably damaging 1.00
R5764:Jag1 UTSW 2 137089247 missense probably damaging 1.00
R5804:Jag1 UTSW 2 137088204 missense probably benign 0.01
R6406:Jag1 UTSW 2 137087643 missense probably damaging 1.00
R6503:Jag1 UTSW 2 137101629 missense probably damaging 1.00
R6721:Jag1 UTSW 2 137094474 missense probably benign 0.00
R6826:Jag1 UTSW 2 137116175 critical splice donor site probably null
R7055:Jag1 UTSW 2 137115489 missense probably benign 0.26
R7214:Jag1 UTSW 2 137106882 missense probably benign 0.00
R7359:Jag1 UTSW 2 137084306 missense probably benign
R7422:Jag1 UTSW 2 137085055 missense probably benign
Z1088:Jag1 UTSW 2 137085151 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CATAGGTACCACCCTGCTTTG -3'
(R):5'- TGCTCCCTTTGCAGAGGTTC -3'

Sequencing Primer
(F):5'- GTTCCCTTCCCCGTTGAG -3'
(R):5'- GCAGAGGTTCTCAGATTTAGGAATC -3'
Posted On2015-10-08