Incidental Mutation 'R4630:Kcnd3'
ID349099
Institutional Source Beutler Lab
Gene Symbol Kcnd3
Ensembl Gene ENSMUSG00000040896
Gene Namepotassium voltage-gated channel, Shal-related family, member 3
SynonymsKv4.3, potassium channel Kv4.3M, potassium channel Kv4.3L
MMRRC Submission 041895-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4630 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location105452330-105674002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 105658766 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 421 (A421V)
Ref Sequence ENSEMBL: ENSMUSP00000113436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079169] [ENSMUST00000098761] [ENSMUST00000118360]
Predicted Effect probably damaging
Transcript: ENSMUST00000079169
AA Change: A421V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078169
Gene: ENSMUSG00000040896
AA Change: A421V

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 3.2e-17 PFAM
BTB 40 139 1.76e-16 SMART
Pfam:Ion_trans 182 414 6.6e-45 PFAM
Pfam:Ion_trans_2 327 408 9.5e-15 PFAM
Pfam:DUF3399 442 563 4.7e-46 PFAM
low complexity region 610 625 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098761
AA Change: A421V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096357
Gene: ENSMUSG00000040896
AA Change: A421V

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 7.3e-19 PFAM
BTB 40 139 1.76e-16 SMART
transmembrane domain 180 202 N/A INTRINSIC
Pfam:Ion_trans 228 402 1e-31 PFAM
Pfam:Ion_trans_2 327 408 8.4e-15 PFAM
low complexity region 412 431 N/A INTRINSIC
Pfam:DUF3399 442 545 9.5e-52 PFAM
low complexity region 591 606 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118360
AA Change: A421V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113436
Gene: ENSMUSG00000040896
AA Change: A421V

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 3.2e-17 PFAM
BTB 40 139 1.76e-16 SMART
Pfam:Ion_trans 182 414 6.6e-45 PFAM
Pfam:Ion_trans_2 327 408 9.5e-15 PFAM
Pfam:DUF3399 442 563 4.7e-46 PFAM
low complexity region 610 625 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141694
Meta Mutation Damage Score 0.354 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member includes two isoforms with different sizes, which are encoded by alternatively spliced transcript variants of this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter (null) allele are viable and fertile and exhibit normal cardiac morphology and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
3110001I22Rik T C 16: 13,677,414 S126P probably damaging Het
3110070M22Rik A T 13: 119,488,086 probably benign Het
4833423E24Rik C A 2: 85,518,646 G41* probably null Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
BC024139 T G 15: 76,125,094 Q240P probably benign Het
Bckdha A T 7: 25,631,459 I44N probably damaging Het
Brpf1 T C 6: 113,309,906 Y32H probably damaging Het
Catip A G 1: 74,368,913 probably benign Het
Ccdc138 T C 10: 58,573,655 L602P probably damaging Het
Cilp A T 9: 65,279,880 T1086S probably benign Het
Comp A T 8: 70,374,382 I58F possibly damaging Het
Crygs T C 16: 22,805,518 E113G possibly damaging Het
Dnmt3b C T 2: 153,670,315 R319* probably null Het
Eif3a A G 19: 60,769,928 I804T unknown Het
Eif3a A T 19: 60,777,986 H301Q probably benign Het
Elf3 A T 1: 135,256,740 probably benign Het
Gm10384 A G 15: 36,871,773 noncoding transcript Het
Gm11627 T A 11: 102,578,831 probably benign Het
Gpr183 A T 14: 121,954,849 Y87N probably damaging Het
Gpr183 G C 14: 121,954,850 Y86* probably null Het
Gpr26 T C 7: 131,966,980 V18A probably damaging Het
Herc1 T A 9: 66,433,714 probably null Het
Hint2 C T 4: 43,656,396 probably benign Het
Jag1 A T 2: 137,085,979 D837E probably damaging Het
Jmjd1c C A 10: 67,157,974 S78* probably null Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lalba T C 15: 98,482,668 M2V probably benign Het
Lama1 T A 17: 67,794,300 D1929E probably benign Het
Macf1 T C 4: 123,473,639 K878R possibly damaging Het
Mboat4 T C 8: 34,123,954 S182P probably damaging Het
Muc5b A T 7: 141,857,984 T1556S unknown Het
Myo1g T C 11: 6,519,047 Y85C probably damaging Het
Ncapd2 C A 6: 125,179,233 probably null Het
Nox3 T C 17: 3,693,982 D96G possibly damaging Het
Olfr23 T C 11: 73,940,996 L250P probably damaging Het
Olfr514 T C 7: 108,825,595 M135V probably damaging Het
Olfr805 A G 10: 129,723,481 L21P probably damaging Het
Pacs1 C T 19: 5,156,356 probably null Het
Pgm5 C A 19: 24,834,746 G141* probably null Het
Pik3r4 A G 9: 105,654,899 M557V probably benign Het
Pld4 T A 12: 112,765,064 V217D probably damaging Het
Ppp1r3c T C 19: 36,733,515 E285G probably benign Het
Pradc1 T A 6: 85,447,293 M24L possibly damaging Het
Prepl T C 17: 85,083,231 T100A probably benign Het
Rmi2 C T 16: 10,886,209 T138I probably benign Het
Rtkn A T 6: 83,152,182 K540* probably null Het
Sag C A 1: 87,834,618 T335K probably damaging Het
Setd4 A G 16: 93,591,226 L124P probably benign Het
Sh3gl2 A G 4: 85,379,409 D208G probably damaging Het
Sult4a1 T C 15: 84,105,578 T8A possibly damaging Het
Tert A G 13: 73,648,991 D1116G probably damaging Het
Tlr4 A G 4: 66,839,240 E90G probably benign Het
Tmem123 T C 9: 7,791,392 L164P probably damaging Het
Tmem246 C G 4: 49,586,254 V305L probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trak1 G A 9: 121,454,425 R419Q probably benign Het
Trp53bp1 G T 2: 121,207,887 A1490D probably damaging Het
Ttc16 T C 2: 32,775,377 probably benign Het
Tyw5 T A 1: 57,388,527 Q306L probably damaging Het
Ube2j2 T A 4: 155,955,258 I14N probably damaging Het
Vmn2r103 T C 17: 19,793,696 I250T probably benign Het
Zar1 A G 5: 72,580,906 V51A probably benign Het
Zbtb38 T G 9: 96,688,851 N60T probably damaging Het
Zfp354a T C 11: 51,070,218 S417P probably damaging Het
Zfp410 A T 12: 84,325,736 D112V probably damaging Het
Zfp518a C T 19: 40,912,979 Q451* probably null Het
Zfp64 T C 2: 168,926,543 N383S possibly damaging Het
Zfp687 A T 3: 95,012,488 probably null Het
Other mutations in Kcnd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02296:Kcnd3 APN 3 105667001 nonsense probably null
PIT4498001:Kcnd3 UTSW 3 105658709 missense probably damaging 0.99
R0483:Kcnd3 UTSW 3 105459626 missense probably damaging 1.00
R0544:Kcnd3 UTSW 3 105658759 missense probably damaging 1.00
R1457:Kcnd3 UTSW 3 105668186 missense probably benign 0.00
R1853:Kcnd3 UTSW 3 105459752 missense probably damaging 1.00
R2030:Kcnd3 UTSW 3 105459537 missense probably damaging 1.00
R2077:Kcnd3 UTSW 3 105666999 missense probably benign 0.16
R2106:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R2287:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R2288:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R2316:Kcnd3 UTSW 3 105669126 missense probably benign 0.17
R2909:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R2924:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R2925:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3014:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3016:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3038:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3696:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3697:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3698:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3777:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3778:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3785:Kcnd3 UTSW 3 105668225 missense possibly damaging 0.79
R3810:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3811:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3815:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3816:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3819:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3877:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3879:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3899:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4300:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4367:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4370:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4491:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4549:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4550:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4569:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4571:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4593:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4594:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4595:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4624:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4625:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4627:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4631:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4632:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4799:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4822:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R5021:Kcnd3 UTSW 3 105658754 missense probably damaging 1.00
R5056:Kcnd3 UTSW 3 105666928 intron probably benign
R5849:Kcnd3 UTSW 3 105458795 utr 5 prime probably benign
R7198:Kcnd3 UTSW 3 105459540 missense probably damaging 1.00
R7224:Kcnd3 UTSW 3 105669084 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATGAAGCCCCACTTGTTTCC -3'
(R):5'- GCTAACTGAGGACATTGGTGG -3'

Sequencing Primer
(F):5'- ACTTGTTTCCCACATGGCC -3'
(R):5'- GGTAGGAGGATACAACACCGCC -3'
Posted On2015-10-08